Incidental Mutation 'R3804:Iqcm'
ID 274499
Institutional Source Beutler Lab
Gene Symbol Iqcm
Ensembl Gene ENSMUSG00000031620
Gene Name IQ motif containing M
Synonyms 1700007B14Rik
MMRRC Submission 040879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R3804 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 75448694-75984503 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 75669393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 188 (T188K)
Ref Sequence ENSEMBL: ENSMUSP00000148495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034033] [ENSMUST00000121983] [ENSMUST00000212704]
AlphaFold Q149I8
Predicted Effect possibly damaging
Transcript: ENSMUST00000034033
AA Change: T188K

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034033
Gene: ENSMUSG00000031620
AA Change: T188K

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121983
AA Change: T188K

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112901
Gene: ENSMUSG00000031620
AA Change: T188K

DomainStartEndE-ValueType
IQ 281 303 2.54e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212704
AA Change: T188K

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Iqcm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Iqcm APN 8 75888560 missense probably damaging 1.00
IGL02835:Iqcm APN 8 75554883 utr 5 prime probably benign
R0056:Iqcm UTSW 8 75753386 missense probably benign
R2146:Iqcm UTSW 8 75888613 missense probably damaging 1.00
R2910:Iqcm UTSW 8 75714776 missense probably benign
R3801:Iqcm UTSW 8 75669393 missense possibly damaging 0.59
R3834:Iqcm UTSW 8 75577752 missense possibly damaging 0.93
R3897:Iqcm UTSW 8 75753400 missense probably damaging 1.00
R4447:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4448:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4450:Iqcm UTSW 8 75629766 missense probably damaging 0.97
R4687:Iqcm UTSW 8 75762989 missense probably damaging 1.00
R4810:Iqcm UTSW 8 75888653 missense probably damaging 1.00
R4845:Iqcm UTSW 8 75746352 missense probably damaging 0.99
R4856:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R4886:Iqcm UTSW 8 75888600 missense possibly damaging 0.95
R5063:Iqcm UTSW 8 75746286 missense probably damaging 1.00
R5460:Iqcm UTSW 8 75714789 missense probably benign
R6403:Iqcm UTSW 8 75577996 critical splice donor site probably null
R6667:Iqcm UTSW 8 75753352 missense probably damaging 1.00
R7187:Iqcm UTSW 8 75753416 missense probably benign 0.22
R7263:Iqcm UTSW 8 75763073 missense probably benign
R7701:Iqcm UTSW 8 75554911 missense probably benign 0.02
R7916:Iqcm UTSW 8 75577950 missense probably benign
R7938:Iqcm UTSW 8 75577968 missense probably benign
R7974:Iqcm UTSW 8 75554892 start codon destroyed probably null 0.66
R8039:Iqcm UTSW 8 75763105 missense probably damaging 1.00
R8703:Iqcm UTSW 8 75888643 missense probably damaging 1.00
R9175:Iqcm UTSW 8 75984239 missense possibly damaging 0.84
RF002:Iqcm UTSW 8 75577899 missense probably benign 0.01
X0018:Iqcm UTSW 8 75984212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGGCTATCGCTTCTTC -3'
(R):5'- GCTGAAGAAATGGCCTTCAATGAAG -3'

Sequencing Primer
(F):5'- TCATCTCTCTCTGACGAGATGACAAG -3'
(R):5'- TTGAGCAGATCCATGAGG -3'
Posted On 2015-04-02