Incidental Mutation 'R3804:Olfr805'
ID274508
Institutional Source Beutler Lab
Gene Symbol Olfr805
Ensembl Gene ENSMUSG00000096858
Gene Nameolfactory receptor 805
SynonymsGA_x6K02T2PULF-11402237-11401278, MOR110-4
MMRRC Submission 040879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3804 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129721221-129729375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129723049 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 165 (D165V)
Ref Sequence ENSEMBL: ENSMUSP00000149493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078876] [ENSMUST00000204717] [ENSMUST00000216794] [ENSMUST00000217219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078876
AA Change: D165V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092874
Gene: ENSMUSG00000096858
AA Change: D165V

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 3.9e-52 PFAM
Pfam:7tm_1 39 288 5.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203573
AA Change: D165V
SMART Domains Protein: ENSMUSP00000144843
Gene: ENSMUSG00000096858
AA Change: D165V

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 3.9e-52 PFAM
Pfam:7tm_1 39 288 5.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204717
Predicted Effect possibly damaging
Transcript: ENSMUST00000216794
AA Change: D165V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217219
AA Change: D165V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Olfr805
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Olfr805 APN 10 129722945 missense probably benign
IGL01341:Olfr805 APN 10 129722878 missense possibly damaging 0.87
IGL01960:Olfr805 APN 10 129722887 missense probably damaging 1.00
IGL02729:Olfr805 APN 10 129723521 missense probably benign 0.01
IGL02969:Olfr805 APN 10 129723196 missense probably damaging 0.99
R0116:Olfr805 UTSW 10 129722977 missense probably damaging 1.00
R1236:Olfr805 UTSW 10 129722806 missense probably damaging 0.98
R1332:Olfr805 UTSW 10 129723247 missense probably damaging 1.00
R2428:Olfr805 UTSW 10 129722783 missense probably benign 0.05
R3725:Olfr805 UTSW 10 129723115 missense probably damaging 1.00
R3726:Olfr805 UTSW 10 129723115 missense probably damaging 1.00
R4365:Olfr805 UTSW 10 129723412 missense probably damaging 0.99
R4630:Olfr805 UTSW 10 129723481 missense probably damaging 1.00
R4735:Olfr805 UTSW 10 129722923 missense probably benign 0.06
R4923:Olfr805 UTSW 10 129722812 missense probably benign 0.03
R4962:Olfr805 UTSW 10 129722723 missense probably damaging 1.00
R5324:Olfr805 UTSW 10 129722945 missense probably benign
R5406:Olfr805 UTSW 10 129722930 missense probably damaging 1.00
R7705:Olfr805 UTSW 10 129723149 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACCATGTGTGAGGAGCAG -3'
(R):5'- TCACAGAGTTCTACCTCCTGGC -3'

Sequencing Primer
(F):5'- CCTTTGTTGAGCTGAAGGGAAC -3'
(R):5'- GGCTGCCATGTCCTATGAC -3'
Posted On2015-04-02