Incidental Mutation 'R3804:Slc43a2'
ID274510
Institutional Source Beutler Lab
Gene Symbol Slc43a2
Ensembl Gene ENSMUSG00000038178
Gene Namesolute carrier family 43, member 2
Synonyms7630402D21Rik
MMRRC Submission 040879-MU
Accession Numbers

Genbank: NM_001199283.1, NM_001199284.1, NM_173388.2; Ensembl: ENSMUST00000042561

Is this an essential gene? Possibly essential (E-score: 0.726) question?
Stock #R3804 (G1)
Quality Score218
Status Validated
Chromosome11
Chromosomal Location75531694-75577575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75563598 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 323 (L323P)
Ref Sequence ENSEMBL: ENSMUSP00000126838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042561] [ENSMUST00000108433] [ENSMUST00000169547]
Predicted Effect probably benign
Transcript: ENSMUST00000042561
AA Change: L323P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000046074
Gene: ENSMUSG00000038178
AA Change: L323P

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.9e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108433
AA Change: L323P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000104071
Gene: ENSMUSG00000038178
AA Change: L323P

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.4e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155981
Predicted Effect probably benign
Transcript: ENSMUST00000169547
AA Change: L323P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126838
Gene: ENSMUSG00000038178
AA Change: L323P

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:MFS_1 58 393 2.4e-15 PFAM
transmembrane domain 426 448 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 482 504 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
low complexity region 538 550 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the L-amino acid transporter-3 or SLC43 family of transporters. The encoded protein mediates sodium-, chloride-, and pH-independent transport of L-isomers of neutral amino acids, including leucine, phenylalanine, valine and methionine. This protein may contribute to the transfer of amino acids across the placental membrane to the fetus. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display fetal growth retardation, abnormal placental amino acid transport, slow postnatal weight gain, malnutrition and postnatal lethality, likely as a result of impaired intestinal amino acid absorption. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Gene trapped(7)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Slc43a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Slc43a2 APN 11 75545751 splice site probably null
IGL03009:Slc43a2 APN 11 75572376 missense probably benign
IGL03145:Slc43a2 APN 11 75568437 missense probably benign 0.27
1mM(1):Slc43a2 UTSW 11 75566996 missense possibly damaging 0.80
R0051:Slc43a2 UTSW 11 75562850 missense probably damaging 1.00
R0051:Slc43a2 UTSW 11 75562850 missense probably damaging 1.00
R0133:Slc43a2 UTSW 11 75563577 missense probably benign 0.22
R0443:Slc43a2 UTSW 11 75544667 splice site probably benign
R0841:Slc43a2 UTSW 11 75566989 nonsense probably null
R1145:Slc43a2 UTSW 11 75566989 nonsense probably null
R1145:Slc43a2 UTSW 11 75566989 nonsense probably null
R1215:Slc43a2 UTSW 11 75562862 missense probably damaging 1.00
R1499:Slc43a2 UTSW 11 75562907 critical splice donor site probably null
R1943:Slc43a2 UTSW 11 75545741 splice site probably null
R2438:Slc43a2 UTSW 11 75563131 missense possibly damaging 0.90
R2512:Slc43a2 UTSW 11 75570577 missense probably damaging 1.00
R3726:Slc43a2 UTSW 11 75543154 splice site probably benign
R4830:Slc43a2 UTSW 11 75543293 missense probably damaging 1.00
R5650:Slc43a2 UTSW 11 75545807 missense probably damaging 1.00
R6042:Slc43a2 UTSW 11 75570607 missense probably damaging 0.98
R6171:Slc43a2 UTSW 11 75563050 missense probably damaging 1.00
R6196:Slc43a2 UTSW 11 75568380 nonsense probably null
R6264:Slc43a2 UTSW 11 75567074 missense possibly damaging 0.90
R6597:Slc43a2 UTSW 11 75571855 missense probably damaging 1.00
R7681:Slc43a2 UTSW 11 75563673 missense probably benign 0.02
R7787:Slc43a2 UTSW 11 75563074 missense probably damaging 1.00
R8174:Slc43a2 UTSW 11 75543367 critical splice donor site probably null
X0060:Slc43a2 UTSW 11 75532665 missense probably null 0.91
Predicted Primers PCR Primer
(F):5'- TGAGTTCCGCAGAGCTTAGG -3'
(R):5'- ATGCATCAAGGAAGGCCCAG -3'

Sequencing Primer
(F):5'- GCTGATGAGCATCAAGACCACAG -3'
(R):5'- AGGCCCAGAGGTATGTGTG -3'
Posted On2015-04-02