Incidental Mutation 'R3804:Nf1'
ID 274511
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Name neurofibromin 1
Synonyms Nf-1, neurofibromin
MMRRC Submission 040879-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3804 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 79339693-79581612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79559521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 511 (D511G)
Ref Sequence ENSEMBL: ENSMUSP00000120982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000137997]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000071325
AA Change: D2527G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: D2527G

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108251
AA Change: D2506G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: D2506G

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137997
AA Change: D511G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120982
Gene: ENSMUSG00000020716
AA Change: D511G

DomainStartEndE-ValueType
low complexity region 604 614 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146699
Meta Mutation Damage Score 0.4367 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Diesel UTSW 11 79556723 missense probably damaging 0.96
Franklin UTSW 11 79473320 splice site probably null
Gasoline UTSW 11 79556789 missense probably benign 0.17
hancock UTSW 11 79536850 missense probably benign
independence UTSW 11 79454310 intron probably benign
jackson UTSW 11 79447572 missense probably damaging 1.00
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
responsibility UTSW 11 79565975 missense probably damaging 0.99
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 splice site probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
R7007:Nf1 UTSW 11 79447023 splice site probably null
R7066:Nf1 UTSW 11 79556720 missense probably damaging 1.00
R7099:Nf1 UTSW 11 79570330 missense probably benign 0.08
R7213:Nf1 UTSW 11 79469819 missense probably benign 0.23
R7326:Nf1 UTSW 11 79564943 missense probably benign
R7348:Nf1 UTSW 11 79536850 missense probably benign
R7380:Nf1 UTSW 11 79546276 missense probably damaging 1.00
R7407:Nf1 UTSW 11 79448143 missense probably damaging 1.00
R7412:Nf1 UTSW 11 79473414 missense probably damaging 1.00
R7545:Nf1 UTSW 11 79409524 missense probably benign
R7567:Nf1 UTSW 11 79547226 missense probably damaging 0.99
R7574:Nf1 UTSW 11 79408769 missense probably null 0.99
R7616:Nf1 UTSW 11 79384266 missense probably damaging 0.97
R7713:Nf1 UTSW 11 79425606 missense probably benign
R7737:Nf1 UTSW 11 79545488 missense probably benign 0.33
R7869:Nf1 UTSW 11 79418588 missense probably damaging 1.00
R7905:Nf1 UTSW 11 79547112 missense possibly damaging 0.80
R8232:Nf1 UTSW 11 79578331 missense probably damaging 0.96
R8244:Nf1 UTSW 11 79440924 missense probably benign
R8397:Nf1 UTSW 11 79547692 missense probably damaging 1.00
R8436:Nf1 UTSW 11 79458883 missense probably damaging 0.99
R8492:Nf1 UTSW 11 79408422 missense probably benign 0.06
R8719:Nf1 UTSW 11 79390293 missense possibly damaging 0.86
R8735:Nf1 UTSW 11 79454310 intron probably benign
R8795:Nf1 UTSW 11 79425616 missense probably damaging 1.00
R8797:Nf1 UTSW 11 79475885 critical splice donor site probably benign
R8809:Nf1 UTSW 11 79547138 missense probably damaging 0.99
R8812:Nf1 UTSW 11 79546354 missense probably damaging 0.96
R8815:Nf1 UTSW 11 79441665 missense probably damaging 1.00
R8828:Nf1 UTSW 11 79395853 critical splice acceptor site probably null
R8894:Nf1 UTSW 11 79445793 missense probably damaging 1.00
R9051:Nf1 UTSW 11 79473342 missense probably damaging 1.00
R9103:Nf1 UTSW 11 79559506 missense probably damaging 0.99
R9142:Nf1 UTSW 11 79471489 missense probably damaging 1.00
R9142:Nf1 UTSW 11 79475862 missense probably damaging 1.00
R9170:Nf1 UTSW 11 79545465 missense probably damaging 1.00
R9201:Nf1 UTSW 11 79570330 missense probably benign 0.08
R9267:Nf1 UTSW 11 79440890 missense possibly damaging 0.72
R9309:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R9340:Nf1 UTSW 11 79556803 missense possibly damaging 0.90
R9398:Nf1 UTSW 11 79547192 missense probably damaging 0.99
R9471:Nf1 UTSW 11 79545369 missense probably damaging 0.99
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Z1177:Nf1 UTSW 11 79564925 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTATTAGGAATGAGTGAACAGTGGT -3'
(R):5'- TTAGAGGAGCCAGCCACACA -3'

Sequencing Primer
(F):5'- CTCTCCCAAAGGTTCAGA -3'
(R):5'- CCAGGTACACATGTGGTATGCATC -3'
Posted On 2015-04-02