Incidental Mutation 'R3804:Icam2'
ID274514
Institutional Source Beutler Lab
Gene Symbol Icam2
Ensembl Gene ENSMUSG00000001029
Gene Nameintercellular adhesion molecule 2
SynonymsCD102, Icam-2
MMRRC Submission 040879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3804 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106377656-106388075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106380822 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 94 (L94P)
Ref Sequence ENSEMBL: ENSMUSP00000118043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001055] [ENSMUST00000009354] [ENSMUST00000106813] [ENSMUST00000106816] [ENSMUST00000141146] [ENSMUST00000185986] [ENSMUST00000188561] [ENSMUST00000190268] [ENSMUST00000190795]
Predicted Effect probably damaging
Transcript: ENSMUST00000001055
AA Change: L58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001055
Gene: ENSMUSG00000001029
AA Change: L58P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 8.6e-45 PFAM
Blast:IG_like 119 215 2e-36 BLAST
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000009354
SMART Domains Protein: ENSMUSP00000009354
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106809
Predicted Effect probably damaging
Transcript: ENSMUST00000106813
AA Change: L58P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102426
Gene: ENSMUSG00000001029
AA Change: L58P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 2.8e-45 PFAM
Blast:IG_like 119 161 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106816
SMART Domains Protein: ENSMUSP00000102429
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141146
AA Change: L94P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118043
Gene: ENSMUSG00000001029
AA Change: L94P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ICAM_N 58 138 2.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173795
SMART Domains Protein: ENSMUSP00000133315
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
Pfam:ICAM_N 1 50 2.2e-21 PFAM
Blast:IG_like 55 151 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185986
SMART Domains Protein: ENSMUSP00000140365
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 32 103 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188561
SMART Domains Protein: ENSMUSP00000140194
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 101 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190268
SMART Domains Protein: ENSMUSP00000139960
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190795
SMART Domains Protein: ENSMUSP00000140541
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Meta Mutation Damage Score 0.6449 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in increased respiratory responsiveness due to an increased accumulation of eosinophils in the lung interstitium and a concomittant delay in the increase of eosinophils in the airway lumen during the development of an allergic inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Icam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0646:Icam2 UTSW 11 106380891 missense probably damaging 0.97
R1651:Icam2 UTSW 11 106377956 missense probably damaging 1.00
R2026:Icam2 UTSW 11 106382442 missense probably benign 0.01
R4092:Icam2 UTSW 11 106380797 start codon destroyed probably null
R5395:Icam2 UTSW 11 106382473 splice site probably null
R6575:Icam2 UTSW 11 106378759 missense probably damaging 0.99
R6722:Icam2 UTSW 11 106382481 missense probably damaging 0.99
R7221:Icam2 UTSW 11 106382442 missense probably benign 0.01
R7579:Icam2 UTSW 11 106380763 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGTACTGGGGAGTAGAGC -3'
(R):5'- ACCAAAGGTGACCTGTCTCC -3'

Sequencing Primer
(F):5'- GGGAGTAGAGCCCCCAG -3'
(R):5'- CTCCTTGGGCCACTGGTAATAGAG -3'
Posted On2015-04-02