Incidental Mutation 'R3805:Olfr1187-ps1'
ID274536
Institutional Source Beutler Lab
Gene Symbol Olfr1187-ps1
Ensembl Gene ENSMUSG00000068810
Gene Nameolfactory receptor 1187, pseudogene 1
SynonymsGA_x6K02T2Q125-50027818-50027495
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88540124-88540447 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 88540356 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000088203
Gene: ENSMUSG00000068810

DomainStartEndE-ValueType
SCOP:d1l9ha_ 19 99 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177576
SMART Domains Protein: ENSMUSP00000137535
Gene: ENSMUSG00000068810

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Meta Mutation Damage Score 0.3289 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Olfr1187-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02974:Olfr1187-ps1 APN 2 88540235 synonymous silent
IGL03348:Olfr1187-ps1 APN 2 88540141 exon noncoding transcript
R0784:Olfr1187-ps1 UTSW 2 88540167 exon noncoding transcript
R3724:Olfr1187-ps1 UTSW 2 88540286 exon noncoding transcript
R3806:Olfr1187-ps1 UTSW 2 88540356 exon noncoding transcript
R5235:Olfr1187-ps1 UTSW 2 88540425 exon noncoding transcript
R5464:Olfr1187-ps1 UTSW 2 88540255 splice site probably null
R5888:Olfr1187-ps1 UTSW 2 88540244 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAGGGAGTATAAAATCAGCTTTGGAG -3'
(R):5'- AGAATGCCCAGCAATACAGTAA -3'

Sequencing Primer
(F):5'- CTTTGGAGCAATGACAGAAGAAAAC -3'
(R):5'- GCCCAGCAATACAGTAATTGAATATG -3'
Posted On2015-04-02