Incidental Mutation 'R3805:Olfr1270'
ID274537
Institutional Source Beutler Lab
Gene Symbol Olfr1270
Ensembl Gene ENSMUSG00000075065
Gene Nameolfactory receptor 1270
SynonymsMOR227-1, GA_x6K02T2Q125-51584440-51583526
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90145255-90153091 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to G at 90148461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099754] [ENSMUST00000213946] [ENSMUST00000215578] [ENSMUST00000215975] [ENSMUST00000216354] [ENSMUST00000217139]
Predicted Effect probably benign
Transcript: ENSMUST00000099754
SMART Domains Protein: ENSMUSP00000097343
Gene: ENSMUSG00000075065

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 300 7.5e-6 PFAM
Pfam:7tm_1 39 285 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165784
SMART Domains Protein: ENSMUSP00000126140
Gene: ENSMUSG00000091703

DomainStartEndE-ValueType
HOX 19 81 1.29e-3 SMART
low complexity region 118 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213946
Predicted Effect probably benign
Transcript: ENSMUST00000215578
Predicted Effect probably benign
Transcript: ENSMUST00000215975
Predicted Effect probably benign
Transcript: ENSMUST00000216354
Predicted Effect probably benign
Transcript: ENSMUST00000217139
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Olfr1270
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Olfr1270 APN 2 90149353 missense possibly damaging 0.61
IGL03034:Olfr1270 APN 2 90149833 missense probably damaging 1.00
R0726:Olfr1270 UTSW 2 90149283 missense probably damaging 1.00
R1573:Olfr1270 UTSW 2 90148724 utr 3 prime probably benign
R1965:Olfr1270 UTSW 2 90149404 missense probably damaging 0.98
R1966:Olfr1270 UTSW 2 90149404 missense probably damaging 0.98
R2353:Olfr1270 UTSW 2 90149718 missense probably damaging 0.98
R4606:Olfr1270 UTSW 2 90148816 utr 3 prime probably benign
R4662:Olfr1270 UTSW 2 90149878 missense probably damaging 1.00
R6198:Olfr1270 UTSW 2 90149438 missense probably damaging 1.00
R6596:Olfr1270 UTSW 2 90149278 missense possibly damaging 0.73
R6957:Olfr1270 UTSW 2 90149150 nonsense probably null
R7408:Olfr1270 UTSW 2 90149844 missense probably benign
R7418:Olfr1270 UTSW 2 90149487 missense probably damaging 1.00
R7454:Olfr1270 UTSW 2 90149419 missense possibly damaging 0.78
R7935:Olfr1270 UTSW 2 90149584 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACTCCAGCCATAATAGAAGCAGG -3'
(R):5'- CGCTGAGTGATGAACCAGGATC -3'

Sequencing Primer
(F):5'- CCAGCCATAATAGAAGCAGGTATCAG -3'
(R):5'- AACCAGGATCTGATGAGGTCTTTC -3'
Posted On2015-04-02