Incidental Mutation 'R3805:Lingo4'
ID274539
Institutional Source Beutler Lab
Gene Symbol Lingo4
Ensembl Gene ENSMUSG00000044505
Gene Nameleucine rich repeat and Ig domain containing 4
SynonymsLrrn6d, LERN4, A530050P17Rik
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94398517-94404501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94402100 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 115 (D115G)
Ref Sequence ENSEMBL: ENSMUSP00000058050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029795] [ENSMUST00000050975] [ENSMUST00000197040] [ENSMUST00000200009]
Predicted Effect probably benign
Transcript: ENSMUST00000029795
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000050975
AA Change: D115G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058050
Gene: ENSMUSG00000044505
AA Change: D115G

DomainStartEndE-ValueType
LRRNT 55 89 1.23e-4 SMART
LRR 88 107 2.76e2 SMART
LRR_TYP 108 131 1.02e-6 SMART
LRR_TYP 132 155 7.26e-3 SMART
LRR 156 179 1.33e1 SMART
LRR_TYP 180 203 5.42e-2 SMART
LRR 204 227 4.45e1 SMART
LRR 228 251 3.27e1 SMART
LRR 300 323 4.83e0 SMART
LRR 324 347 3.07e-1 SMART
LRR 348 371 3.36e1 SMART
LRRCT 383 436 5.24e-5 SMART
IGc2 451 516 3.53e-13 SMART
transmembrane domain 560 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197040
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198829
Predicted Effect probably benign
Transcript: ENSMUST00000200009
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Meta Mutation Damage Score 0.2792 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Lingo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Lingo4 APN 3 94403288 missense probably benign 0.00
IGL02662:Lingo4 APN 3 94401817 unclassified probably benign
IGL02687:Lingo4 APN 3 94402097 missense probably damaging 1.00
IGL02711:Lingo4 APN 3 94403393 missense probably benign
IGL03001:Lingo4 APN 3 94402396 missense probably damaging 1.00
IGL03260:Lingo4 APN 3 94401943 missense probably benign
PIT4449001:Lingo4 UTSW 3 94401932 missense probably benign
R0088:Lingo4 UTSW 3 94402033 missense probably benign 0.39
R0616:Lingo4 UTSW 3 94403081 missense probably benign 0.00
R1455:Lingo4 UTSW 3 94399392 unclassified probably benign
R1733:Lingo4 UTSW 3 94403178 missense probably benign 0.00
R2001:Lingo4 UTSW 3 94403075 missense probably damaging 1.00
R2085:Lingo4 UTSW 3 94402245 missense probably damaging 1.00
R3793:Lingo4 UTSW 3 94402378 missense probably benign
R3806:Lingo4 UTSW 3 94402100 missense probably damaging 1.00
R4438:Lingo4 UTSW 3 94402897 missense possibly damaging 0.79
R4660:Lingo4 UTSW 3 94403365 missense probably benign 0.00
R4724:Lingo4 UTSW 3 94402876 nonsense probably null
R4981:Lingo4 UTSW 3 94399454 missense probably benign 0.18
R4994:Lingo4 UTSW 3 94402541 missense probably benign
R4994:Lingo4 UTSW 3 94403001 missense probably benign 0.02
R5600:Lingo4 UTSW 3 94401913 missense probably benign
R6188:Lingo4 UTSW 3 94402850 missense probably damaging 1.00
R6267:Lingo4 UTSW 3 94403390 missense probably benign 0.02
R6303:Lingo4 UTSW 3 94403206 missense probably damaging 1.00
R6304:Lingo4 UTSW 3 94403206 missense probably damaging 1.00
R6789:Lingo4 UTSW 3 94399355 unclassified probably benign
R7313:Lingo4 UTSW 3 94403144 missense possibly damaging 0.95
R7329:Lingo4 UTSW 3 94402855 missense probably benign
R7631:Lingo4 UTSW 3 94399460 missense possibly damaging 0.93
R7908:Lingo4 UTSW 3 94402234 missense probably benign 0.19
R8277:Lingo4 UTSW 3 94402624 missense possibly damaging 0.61
X0054:Lingo4 UTSW 3 94403376 missense possibly damaging 0.54
Z1177:Lingo4 UTSW 3 94402994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATCTATTCCAGGCCTCAGG -3'
(R):5'- GGACAATCTGATTGAGGCGG -3'

Sequencing Primer
(F):5'- TATTCCAGGCCTCAGGGGATG -3'
(R):5'- CAATCTGATTGAGGCGGAGGTC -3'
Posted On2015-04-02