Incidental Mutation 'R3805:Map7d1'
ID274543
Institutional Source Beutler Lab
Gene Symbol Map7d1
Ensembl Gene ENSMUSG00000028849
Gene NameMAP7 domain containing 1
SynonymsMtap7d1, Parcc1, Rprc1
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126232167-126256343 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 126237291 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000061143] [ENSMUST00000106132] [ENSMUST00000122129]
Predicted Effect probably null
Transcript: ENSMUST00000061143
SMART Domains Protein: ENSMUSP00000054338
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 323 343 N/A INTRINSIC
coiled coil region 414 444 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 533 558 N/A INTRINSIC
Pfam:MAP7 587 735 7.1e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106132
SMART Domains Protein: ENSMUSP00000101738
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 342 372 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
low complexity region 408 425 N/A INTRINSIC
low complexity region 461 486 N/A INTRINSIC
Pfam:MAP7 510 668 1.4e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122129
SMART Domains Protein: ENSMUSP00000113250
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 382 412 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
low complexity region 448 465 N/A INTRINSIC
low complexity region 501 526 N/A INTRINSIC
Pfam:MAP7 550 708 1.5e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125981
SMART Domains Protein: ENSMUSP00000120292
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 68 88 N/A INTRINSIC
coiled coil region 158 188 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
low complexity region 278 303 N/A INTRINSIC
Pfam:MAP7 332 480 1.5e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137382
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Map7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Map7d1 APN 4 126238605 missense probably damaging 1.00
IGL02298:Map7d1 APN 4 126233921 missense unknown
R0136:Map7d1 UTSW 4 126236631 critical splice donor site probably null
R0362:Map7d1 UTSW 4 126234994 missense probably damaging 1.00
R1138:Map7d1 UTSW 4 126242119 missense possibly damaging 0.82
R1499:Map7d1 UTSW 4 126234765 critical splice donor site probably null
R1692:Map7d1 UTSW 4 126242308 missense probably damaging 0.99
R4369:Map7d1 UTSW 4 126235073 missense probably damaging 0.99
R4814:Map7d1 UTSW 4 126234321 critical splice donor site probably null
R4893:Map7d1 UTSW 4 126233222 missense unknown
R4898:Map7d1 UTSW 4 126233225 missense unknown
R4911:Map7d1 UTSW 4 126236691 missense probably damaging 1.00
R4949:Map7d1 UTSW 4 126235053 nonsense probably null
R5189:Map7d1 UTSW 4 126242304 unclassified probably null
R6198:Map7d1 UTSW 4 126241843 missense probably damaging 1.00
R6336:Map7d1 UTSW 4 126236682 missense probably damaging 1.00
R6558:Map7d1 UTSW 4 126232909 missense unknown
R6781:Map7d1 UTSW 4 126240751 frame shift probably null
R7177:Map7d1 UTSW 4 126236985 missense probably damaging 1.00
R7204:Map7d1 UTSW 4 126256015 critical splice donor site probably null
R7269:Map7d1 UTSW 4 126232873 missense unknown
R7486:Map7d1 UTSW 4 126234386 missense unknown
R7560:Map7d1 UTSW 4 126236636 missense probably damaging 1.00
Z1177:Map7d1 UTSW 4 126234377 missense unknown
Predicted Primers PCR Primer
(F):5'- TTAGGTTAGGTTAGCAGAGCCCG -3'
(R):5'- GTTGCCTGTGTCTGCAAAAG -3'

Sequencing Primer
(F):5'- TTAGCTGTGGCCACTCACCG -3'
(R):5'- CCTGTGTCTGCAAAAGGAGCAC -3'
Posted On2015-04-02