Incidental Mutation 'R3805:Speer4a'
ID274544
Institutional Source Beutler Lab
Gene Symbol Speer4a
Ensembl Gene ENSMUSG00000073119
Gene Namespermatogenesis associated glutamate (E)-rich protein 4A
Synonyms1700027N01Rik, SPEER-4A
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3805 (G1)
Quality Score167
Status Validated
Chromosome5
Chromosomal Location26032846-26039558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26035084 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 223 (E223K)
Ref Sequence ENSEMBL: ENSMUSP00000078415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079447
AA Change: E223K

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078415
Gene: ENSMUSG00000073119
AA Change: E223K

DomainStartEndE-ValueType
Pfam:Takusan 50 134 1.7e-26 PFAM
low complexity region 135 146 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 183 223 N/A INTRINSIC
low complexity region 248 261 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Speer4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Speer4a APN 5 26035047 missense possibly damaging 0.95
IGL01959:Speer4a APN 5 26035904 nonsense probably null
IGL02294:Speer4a APN 5 26038242 missense probably benign 0.21
FR4340:Speer4a UTSW 5 26036748 nonsense probably null
FR4342:Speer4a UTSW 5 26036748 nonsense probably null
FR4589:Speer4a UTSW 5 26036748 nonsense probably null
R0137:Speer4a UTSW 5 26035984 missense possibly damaging 0.95
R1068:Speer4a UTSW 5 26036026 missense probably null 0.84
R1209:Speer4a UTSW 5 26035125 critical splice acceptor site probably null
R4525:Speer4a UTSW 5 26039343 critical splice donor site probably null
R4851:Speer4a UTSW 5 26038212 missense probably damaging 0.99
R5326:Speer4a UTSW 5 26036738 missense probably damaging 0.99
R5542:Speer4a UTSW 5 26036738 missense probably damaging 0.99
R6081:Speer4a UTSW 5 26034962 nonsense probably null
R6742:Speer4a UTSW 5 26036056 splice site probably null
R7521:Speer4a UTSW 5 26036765 missense probably damaging 1.00
Z1177:Speer4a UTSW 5 26035038 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCCCTGAATCAGCCATGG -3'
(R):5'- TTTTCAGCCCAGGTTTTGTGAC -3'

Sequencing Primer
(F):5'- GCCATGGCTTCCTCGGTAG -3'
(R):5'- GTCTGCAGATTTCACAGCAG -3'
Posted On2015-04-02