Incidental Mutation 'R3805:Get4'
ID274546
Institutional Source Beutler Lab
Gene Symbol Get4
Ensembl Gene ENSMUSG00000025858
Gene Namegolgi to ER traffic protein 4
Synonyms
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3805 (G1)
Quality Score189
Status Validated
Chromosome5
Chromosomal Location139252324-139270051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 139252531 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 23 (V23F)
Ref Sequence ENSEMBL: ENSMUSP00000117473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026976] [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000110878] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000130326] [ENSMUST00000138508]
Predicted Effect probably damaging
Transcript: ENSMUST00000026976
AA Change: V23F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026976
Gene: ENSMUSG00000025858
AA Change: V23F

DomainStartEndE-ValueType
low complexity region 1 8 N/A INTRINSIC
low complexity region 12 22 N/A INTRINSIC
Pfam:DUF410 56 306 4.6e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058716
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078690
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110878
SMART Domains Protein: ENSMUSP00000106502
Gene: ENSMUSG00000025858

DomainStartEndE-ValueType
Pfam:DUF410 1 250 2.6e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110882
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110883
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110884
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127310
SMART Domains Protein: ENSMUSP00000114514
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
PDB:4DXS|A 38 73 3e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000130326
AA Change: V23F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117473
Gene: ENSMUSG00000025858
AA Change: V23F

DomainStartEndE-ValueType
low complexity region 1 8 N/A INTRINSIC
low complexity region 12 22 N/A INTRINSIC
Pfam:DUF410 54 246 1.1e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138508
SMART Domains Protein: ENSMUSP00000116975
Gene: ENSMUSG00000025858

DomainStartEndE-ValueType
Pfam:DUF410 1 197 4.5e-82 PFAM
Meta Mutation Damage Score 0.1510 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Get4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Get4 APN 5 139252522 missense probably damaging 0.99
IGL02219:Get4 APN 5 139263629 critical splice donor site probably null
IGL02348:Get4 APN 5 139252499 missense probably benign 0.13
R0741:Get4 UTSW 5 139263629 critical splice donor site probably benign
R3807:Get4 UTSW 5 139252531 missense probably damaging 0.98
R6609:Get4 UTSW 5 139269065 unclassified probably benign
R7026:Get4 UTSW 5 139252603 missense possibly damaging 0.94
R8066:Get4 UTSW 5 139263538 missense probably damaging 0.99
R8292:Get4 UTSW 5 139262931 missense probably null 0.01
R8428:Get4 UTSW 5 139265638 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCAGGGTCCTTCTCAGAC -3'
(R):5'- AGCCGCATAAACCAATGAGG -3'

Sequencing Primer
(F):5'- TCCGCCTCGATCACGTG -3'
(R):5'- CGCATAAACCAATGAGGGTGCG -3'
Posted On2015-04-02