Incidental Mutation 'R3805:Rsph10b'
ID274547
Institutional Source Beutler Lab
Gene Symbol Rsph10b
Ensembl Gene ENSMUSG00000075569
Gene Nameradial spoke head 10 homolog B (Chlamydomonas)
SynonymsRsph10b2, 4930526H21Rik
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143933035-143985719 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 143958388 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166847] [ENSMUST00000166847] [ENSMUST00000212711]
Predicted Effect probably null
Transcript: ENSMUST00000166847
SMART Domains Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
MORN 177 198 1.84e0 SMART
MORN 202 223 3.21e1 SMART
MORN 225 246 1.67e-6 SMART
MORN 249 270 1.85e1 SMART
MORN 282 303 2.71e-6 SMART
MORN 305 326 3.53e-5 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
coiled coil region 787 841 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166847
SMART Domains Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
MORN 177 198 1.84e0 SMART
MORN 202 223 3.21e1 SMART
MORN 225 246 1.67e-6 SMART
MORN 249 270 1.85e1 SMART
MORN 282 303 2.71e-6 SMART
MORN 305 326 3.53e-5 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
coiled coil region 787 841 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167009
Predicted Effect probably benign
Transcript: ENSMUST00000212711
Meta Mutation Damage Score 0.9475 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Rsph10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rsph10b APN 5 143937087 makesense probably null
K7894:Rsph10b UTSW 5 143944520 missense probably damaging 1.00
R0136:Rsph10b UTSW 5 143959821 missense probably benign 0.05
R0149:Rsph10b UTSW 5 143938909 unclassified probably benign
R0326:Rsph10b UTSW 5 143967128 missense probably damaging 1.00
R0558:Rsph10b UTSW 5 143949338 missense probably benign 0.02
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1712:Rsph10b UTSW 5 143937149 missense probably damaging 0.96
R1832:Rsph10b UTSW 5 143967179 missense possibly damaging 0.79
R1909:Rsph10b UTSW 5 143985491 missense probably benign 0.09
R2044:Rsph10b UTSW 5 143967250 splice site probably null
R2155:Rsph10b UTSW 5 143961256 missense probably benign 0.05
R2842:Rsph10b UTSW 5 143979892 missense possibly damaging 0.81
R4031:Rsph10b UTSW 5 143985668 splice site probably null
R4792:Rsph10b UTSW 5 143937317 missense probably damaging 1.00
R4866:Rsph10b UTSW 5 143948529 missense probably benign 0.28
R6090:Rsph10b UTSW 5 143977128 missense probably benign 0.00
R6252:Rsph10b UTSW 5 143937121 missense possibly damaging 0.70
R6255:Rsph10b UTSW 5 143959746 missense probably damaging 1.00
R6518:Rsph10b UTSW 5 143963873 missense probably damaging 1.00
R7085:Rsph10b UTSW 5 143949284 missense possibly damaging 0.82
R7206:Rsph10b UTSW 5 143961192 missense possibly damaging 0.86
R7337:Rsph10b UTSW 5 143961215 missense probably benign 0.11
R7353:Rsph10b UTSW 5 143967220 missense possibly damaging 0.73
R7567:Rsph10b UTSW 5 143949426 missense possibly damaging 0.78
R8022:Rsph10b UTSW 5 143967232 missense probably benign 0.00
R8109:Rsph10b UTSW 5 143985530 missense probably benign 0.00
R8275:Rsph10b UTSW 5 143966505 missense possibly damaging 0.50
Z1177:Rsph10b UTSW 5 143977134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAGTTTACCCTTGCTTCC -3'
(R):5'- TGACCCCACCTTCTATGAGTG -3'

Sequencing Primer
(F):5'- GGAGTTTACCCTTGCTTCCCATAATC -3'
(R):5'- CCACCTTCTATGAGTGAGGGG -3'
Posted On2015-04-02