Incidental Mutation 'R3805:Bicd1'
ID274553
Institutional Source Beutler Lab
Gene Symbol Bicd1
Ensembl Gene ENSMUSG00000003452
Gene NameBICD cargo adaptor 1
SynonymsB830009D06Rik
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location149408886-149563329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149518991 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 780 (L780M)
Ref Sequence ENSEMBL: ENSMUSP00000133727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000172926] [ENSMUST00000173408]
Predicted Effect probably damaging
Transcript: ENSMUST00000003544
AA Change: L780M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: L780M

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086829
AA Change: L780M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: L780M

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111513
AA Change: L780M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: L780M

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 822 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172926
AA Change: L79M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133986
Gene: ENSMUSG00000003452
AA Change: L79M

DomainStartEndE-ValueType
Pfam:BicD 1 98 1.2e-69 PFAM
low complexity region 103 120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173408
AA Change: L780M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: L780M

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174886
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Bicd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Bicd1 APN 6 149550390 missense possibly damaging 0.72
IGL02489:Bicd1 APN 6 149513037 missense probably damaging 1.00
IGL02626:Bicd1 APN 6 149409556 missense probably damaging 1.00
IGL02966:Bicd1 APN 6 149483996 missense probably damaging 0.99
IGL03256:Bicd1 APN 6 149513585 missense probably benign
R0123:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0131:Bicd1 UTSW 6 149512947 missense probably damaging 0.99
R0134:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0225:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0267:Bicd1 UTSW 6 149517042 missense probably damaging 1.00
R0481:Bicd1 UTSW 6 149511891 missense possibly damaging 0.90
R0560:Bicd1 UTSW 6 149511962 missense probably benign 0.34
R0729:Bicd1 UTSW 6 149512914 missense probably damaging 0.97
R0784:Bicd1 UTSW 6 149513363 missense probably damaging 0.98
R1994:Bicd1 UTSW 6 149513552 missense probably benign 0.00
R2221:Bicd1 UTSW 6 149517005 missense probably damaging 0.98
R2762:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R3428:Bicd1 UTSW 6 149512902 missense probably damaging 1.00
R3806:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3807:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R4694:Bicd1 UTSW 6 149409553 missense probably damaging 1.00
R4822:Bicd1 UTSW 6 149519254 intron probably benign
R4835:Bicd1 UTSW 6 149484090 missense probably benign 0.00
R5157:Bicd1 UTSW 6 149520414 missense probably benign 0.09
R5527:Bicd1 UTSW 6 149494636 missense probably damaging 1.00
R5611:Bicd1 UTSW 6 149513456 nonsense probably null
R5643:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5644:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5788:Bicd1 UTSW 6 149484000 missense probably benign 0.39
R5898:Bicd1 UTSW 6 149513703 missense probably damaging 0.99
R6222:Bicd1 UTSW 6 149512965 missense probably damaging 1.00
R6227:Bicd1 UTSW 6 149513176 nonsense probably null
R6522:Bicd1 UTSW 6 149484005 missense probably benign
R6781:Bicd1 UTSW 6 149513166 missense possibly damaging 0.86
R6812:Bicd1 UTSW 6 149409537 missense probably damaging 1.00
R7010:Bicd1 UTSW 6 149494615 missense probably damaging 1.00
R7203:Bicd1 UTSW 6 149512905 missense possibly damaging 0.91
R7265:Bicd1 UTSW 6 149513876 missense probably damaging 1.00
R7362:Bicd1 UTSW 6 149484093 missense probably benign 0.13
R7526:Bicd1 UTSW 6 149513726 missense possibly damaging 0.46
R7545:Bicd1 UTSW 6 149513492 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATGGACATCAATATCTGGGTTG -3'
(R):5'- CCGAATGGTAGGGATCTGTG -3'

Sequencing Primer
(F):5'- CATCAATATCTGGGTTGAGGGTAAG -3'
(R):5'- CCTGACTATGCAGGAGGTAAGTGTC -3'
Posted On2015-04-02