Incidental Mutation 'R3805:Ctu1'
ID274555
Institutional Source Beutler Lab
Gene Symbol Ctu1
Ensembl Gene ENSMUSG00000038888
Gene Namecytosolic thiouridylase subunit 1
SynonymsAtpbd3
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43672016-43678298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43676673 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 252 (L252P)
Ref Sequence ENSEMBL: ENSMUSP00000036770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038332]
Predicted Effect probably damaging
Transcript: ENSMUST00000038332
AA Change: L252P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036770
Gene: ENSMUSG00000038888
AA Change: L252P

DomainStartEndE-ValueType
Pfam:ATP_bind_3 53 250 2.9e-19 PFAM
low complexity region 273 284 N/A INTRINSIC
Pfam:zn-ribbon_14 285 316 6e-16 PFAM
internal_repeat_1 349 379 7.14e-12 PROSPERO
internal_repeat_1 389 417 7.14e-12 PROSPERO
Meta Mutation Damage Score 0.9264 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Ctu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ctu1 APN 7 43675504 missense possibly damaging 0.93
waverer UTSW 7 43676622 missense probably damaging 0.96
R0557:Ctu1 UTSW 7 43677159 missense unknown
R2974:Ctu1 UTSW 7 43675650 splice site probably benign
R3807:Ctu1 UTSW 7 43676673 missense probably damaging 1.00
R6863:Ctu1 UTSW 7 43676622 missense probably damaging 0.96
R6999:Ctu1 UTSW 7 43675238 missense probably damaging 0.99
R7379:Ctu1 UTSW 7 43677066 small deletion probably benign
R7395:Ctu1 UTSW 7 43676595 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AACTTCCTGCGTGGTGATGC -3'
(R):5'- TGTGGAGGCTCAACTTGCAG -3'

Sequencing Primer
(F):5'- GATGCTGGGAGGCTGGC -3'
(R):5'- GGCTCAACTTGCAGCACACG -3'
Posted On2015-04-02