Incidental Mutation 'R3805:Morf4l1'
ID274561
Institutional Source Beutler Lab
Gene Symbol Morf4l1
Ensembl Gene ENSMUSG00000062270
Gene Namemortality factor 4 like 1
SynonymsMRG15, Tex189, MORFRG15, TEG-189
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location90091665-90114774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90095143 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 203 (S203P)
Ref Sequence ENSEMBL: ENSMUSP00000132020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085248] [ENSMUST00000169860] [ENSMUST00000190345] [ENSMUST00000191189] [ENSMUST00000191353]
Predicted Effect probably benign
Transcript: ENSMUST00000085248
AA Change: S242P

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000082346
Gene: ENSMUSG00000062270
AA Change: S242P

DomainStartEndE-ValueType
Pfam:Tudor-knot 11 53 8.9e-11 PFAM
Blast:CHROMO 83 117 4e-6 BLAST
Pfam:MRG 174 348 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169860
AA Change: S203P

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132020
Gene: ENSMUSG00000062270
AA Change: S203P

DomainStartEndE-ValueType
CHROMO 10 78 1.8e-9 SMART
Pfam:MRG 127 311 2.8e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189420
Predicted Effect probably benign
Transcript: ENSMUST00000190345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190377
Predicted Effect probably benign
Transcript: ENSMUST00000191189
AA Change: S176P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140118
Gene: ENSMUSG00000062270
AA Change: S176P

DomainStartEndE-ValueType
CHROMO 10 78 1.1e-11 SMART
Pfam:MRG 100 284 1.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191353
SMART Domains Protein: ENSMUSP00000140023
Gene: ENSMUSG00000062270

DomainStartEndE-ValueType
Pfam:Tudor-knot 11 53 3.1e-8 PFAM
Blast:CHROMO 82 116 2e-6 BLAST
Meta Mutation Damage Score 0.2862 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous null mice display perinatal lethality, cardiac hypertrophy, reduced alveolar space, decreased cell proliferation, congestion of the liver, lung, and spleen, skin edema, and thin skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Morf4l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Morf4l1 APN 9 90093795 missense probably benign 0.16
IGL03309:Morf4l1 APN 9 90103745 missense probably benign
R0848:Morf4l1 UTSW 9 90100449 missense probably benign 0.24
R0893:Morf4l1 UTSW 9 90102350 missense probably damaging 1.00
R1155:Morf4l1 UTSW 9 90094504 missense probably benign 0.11
R1765:Morf4l1 UTSW 9 90102348 missense possibly damaging 0.60
R1972:Morf4l1 UTSW 9 90095214 unclassified probably benign
R3806:Morf4l1 UTSW 9 90095143 missense probably benign 0.10
R3894:Morf4l1 UTSW 9 90094448 missense possibly damaging 0.90
R3895:Morf4l1 UTSW 9 90094448 missense possibly damaging 0.90
R5460:Morf4l1 UTSW 9 90095130 missense probably benign 0.10
R6884:Morf4l1 UTSW 9 90094479 missense probably damaging 1.00
R7088:Morf4l1 UTSW 9 90097380 missense possibly damaging 0.59
R7869:Morf4l1 UTSW 9 90093791 missense probably damaging 1.00
R7876:Morf4l1 UTSW 9 90093806 missense possibly damaging 0.65
R8155:Morf4l1 UTSW 9 90095172 missense probably damaging 1.00
R8223:Morf4l1 UTSW 9 90097422 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAAGTATGGCTCAGACTTAACAAC -3'
(R):5'- TACAGTTACATCTCCCTGCATAGTATC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- AGTATCTGTAATCTTGAACCCACTC -3'
Posted On2015-04-02