Incidental Mutation 'R3805:Ccdc138'
ID274562
Institutional Source Beutler Lab
Gene Symbol Ccdc138
Ensembl Gene ENSMUSG00000038010
Gene Namecoiled-coil domain containing 138
Synonyms6230424H07Rik
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58497948-58576244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58561997 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 553 (I553T)
Ref Sequence ENSEMBL: ENSMUSP00000043040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036576]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036576
AA Change: I553T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043040
Gene: ENSMUSG00000038010
AA Change: I553T

DomainStartEndE-ValueType
coiled coil region 259 339 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Meta Mutation Damage Score 0.1386 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Ccdc138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc138 APN 10 58575715 missense probably damaging 1.00
IGL00957:Ccdc138 APN 10 58529016 splice site probably benign
IGL01012:Ccdc138 APN 10 58540915 critical splice donor site probably null
IGL01725:Ccdc138 APN 10 58528923 missense possibly damaging 0.50
IGL01996:Ccdc138 APN 10 58562030 missense probably damaging 1.00
IGL02083:Ccdc138 APN 10 58544914 splice site probably benign
IGL02652:Ccdc138 APN 10 58513079 missense probably benign 0.00
IGL02820:Ccdc138 APN 10 58528899 splice site probably benign
IGL02934:Ccdc138 APN 10 58573580 splice site probably benign
IGL03231:Ccdc138 APN 10 58573706 missense probably damaging 1.00
R0128:Ccdc138 UTSW 10 58528360 missense probably damaging 1.00
R0271:Ccdc138 UTSW 10 58575823 missense probably damaging 0.99
R0480:Ccdc138 UTSW 10 58561967 missense probably damaging 1.00
R0560:Ccdc138 UTSW 10 58575717 missense probably damaging 1.00
R0645:Ccdc138 UTSW 10 58575720 missense probably damaging 1.00
R1405:Ccdc138 UTSW 10 58545117 splice site probably benign
R2032:Ccdc138 UTSW 10 58513162 missense possibly damaging 0.71
R2097:Ccdc138 UTSW 10 58561937 nonsense probably null
R2350:Ccdc138 UTSW 10 58561893 splice site probably benign
R2571:Ccdc138 UTSW 10 58513222 missense probably benign 0.25
R3787:Ccdc138 UTSW 10 58538270 missense probably damaging 1.00
R4582:Ccdc138 UTSW 10 58507643 critical splice donor site probably null
R4630:Ccdc138 UTSW 10 58573655 missense probably damaging 1.00
R4801:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4802:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4883:Ccdc138 UTSW 10 58561996 missense probably benign 0.03
R4908:Ccdc138 UTSW 10 58544995 missense possibly damaging 0.84
R5032:Ccdc138 UTSW 10 58573636 missense probably damaging 1.00
R5155:Ccdc138 UTSW 10 58507572 missense probably benign 0.00
R5287:Ccdc138 UTSW 10 58575705 missense possibly damaging 0.89
R5683:Ccdc138 UTSW 10 58540819 missense probably damaging 1.00
R5963:Ccdc138 UTSW 10 58575757 missense possibly damaging 0.90
R6530:Ccdc138 UTSW 10 58544968 missense probably damaging 1.00
R7148:Ccdc138 UTSW 10 58538280 missense probably damaging 1.00
R7217:Ccdc138 UTSW 10 58509600 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GGGGTGAATCTAAACTTAGGACCTC -3'
(R):5'- GCAGAAGTGCCTGGTGTATG -3'

Sequencing Primer
(F):5'- TAAAGTGATGGTTCTTTTTGTTTAGC -3'
(R):5'- TGAGGTTAACACGTTCTGATCAGAG -3'
Posted On2015-04-02