Incidental Mutation 'R3805:Fam169a'
ID274566
Institutional Source Beutler Lab
Gene Symbol Fam169a
Ensembl Gene ENSMUSG00000041817
Gene Namefamily with sequence similarity 169, member A
Synonyms
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location97067286-97131013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97097684 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 155 (V155I)
Ref Sequence ENSEMBL: ENSMUSP00000126209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042517] [ENSMUST00000071118] [ENSMUST00000169863]
Predicted Effect probably benign
Transcript: ENSMUST00000042517
AA Change: V155I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000043738
Gene: ENSMUSG00000041817
AA Change: V155I

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071118
SMART Domains Protein: ENSMUSP00000132645
Gene: ENSMUSG00000057762

DomainStartEndE-ValueType
Pfam:MARVEL 19 132 2.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169863
AA Change: V155I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126209
Gene: ENSMUSG00000041817
AA Change: V155I

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Fam169a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Fam169a APN 13 97122699 missense probably benign 0.00
IGL01380:Fam169a APN 13 97091951 missense probably damaging 0.97
IGL01761:Fam169a APN 13 97091918 missense possibly damaging 0.92
IGL02628:Fam169a APN 13 97111288 splice site probably benign
IGL02739:Fam169a APN 13 97094055 splice site probably benign
IGL03171:Fam169a APN 13 97110014 splice site probably benign
IGL03306:Fam169a APN 13 97106989 missense possibly damaging 0.66
IGL03377:Fam169a APN 13 97091873 missense probably benign 0.04
IGL02980:Fam169a UTSW 13 97113680 critical splice donor site probably null
R0282:Fam169a UTSW 13 97097715 splice site probably benign
R1319:Fam169a UTSW 13 97097562 missense probably damaging 1.00
R1468:Fam169a UTSW 13 97118530 missense probably benign 0.01
R1468:Fam169a UTSW 13 97118530 missense probably benign 0.01
R2037:Fam169a UTSW 13 97107092 missense probably benign 0.37
R2380:Fam169a UTSW 13 97118535 splice site probably benign
R4434:Fam169a UTSW 13 97126740 missense probably damaging 1.00
R4435:Fam169a UTSW 13 97126740 missense probably damaging 1.00
R4437:Fam169a UTSW 13 97126740 missense probably damaging 1.00
R4590:Fam169a UTSW 13 97097585 missense probably benign 0.02
R4896:Fam169a UTSW 13 97097592 missense probably damaging 1.00
R5004:Fam169a UTSW 13 97097592 missense probably damaging 1.00
R5276:Fam169a UTSW 13 97118496 missense probably benign 0.01
R5370:Fam169a UTSW 13 97106962 missense probably damaging 1.00
R5687:Fam169a UTSW 13 97093618 missense probably damaging 1.00
R6151:Fam169a UTSW 13 97093630 missense probably damaging 1.00
R7711:Fam169a UTSW 13 97126688 nonsense probably null
R8322:Fam169a UTSW 13 97122752 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGCTGCATATTGTAACTGCTG -3'
(R):5'- CACGCTTCAGTAGGCTTTTC -3'

Sequencing Primer
(F):5'- AACTGCTGTGCCTGCTG -3'
(R):5'- TCCTCTCTCACAGGACAGTAGG -3'
Posted On2015-04-02