Incidental Mutation 'R3805:Dhrs2'
ID274568
Institutional Source Beutler Lab
Gene Symbol Dhrs2
Ensembl Gene ENSMUSG00000022209
Gene Namedehydrogenase/reductase member 2
Synonyms5430405K24Rik, SDR family
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55222007-55241435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55234748 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 32 (N32I)
Ref Sequence ENSEMBL: ENSMUSP00000129115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022820] [ENSMUST00000165432]
Predicted Effect probably benign
Transcript: ENSMUST00000022820
AA Change: N32I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022820
Gene: ENSMUSG00000022209
AA Change: N32I

DomainStartEndE-ValueType
Pfam:adh_short 38 206 2.2e-31 PFAM
Pfam:KR 39 213 1.4e-11 PFAM
Pfam:adh_short_C2 43 279 2.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165432
AA Change: N32I

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129115
Gene: ENSMUSG00000022209
AA Change: N32I

DomainStartEndE-ValueType
Pfam:adh_short 38 233 6.3e-52 PFAM
Pfam:KR 39 213 9.1e-12 PFAM
Pfam:adh_short_C2 43 279 1.8e-36 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Ifit1 A G 19: 34,648,156 I231V probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Dhrs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Dhrs2 APN 14 55234663 missense probably benign 0.00
IGL02510:Dhrs2 APN 14 55236075 missense probably damaging 1.00
IGL02604:Dhrs2 APN 14 55237321 missense possibly damaging 0.88
IGL02746:Dhrs2 APN 14 55241171 missense probably damaging 1.00
IGL03060:Dhrs2 APN 14 55237318 missense probably benign 0.06
R0179:Dhrs2 UTSW 14 55240476 missense probably damaging 1.00
R0358:Dhrs2 UTSW 14 55236117 missense probably damaging 0.99
R0755:Dhrs2 UTSW 14 55234790 missense probably damaging 1.00
R1848:Dhrs2 UTSW 14 55240841 missense probably benign
R1977:Dhrs2 UTSW 14 55234655 start codon destroyed probably null 0.11
R3084:Dhrs2 UTSW 14 55239844 missense probably benign 0.00
R3086:Dhrs2 UTSW 14 55239844 missense probably benign 0.00
R3806:Dhrs2 UTSW 14 55234748 missense probably benign 0.03
R4361:Dhrs2 UTSW 14 55241189 missense probably damaging 0.99
R4754:Dhrs2 UTSW 14 55238748 missense probably damaging 0.97
R4989:Dhrs2 UTSW 14 55237265 missense probably damaging 1.00
R5307:Dhrs2 UTSW 14 55236144 missense possibly damaging 0.71
R7561:Dhrs2 UTSW 14 55237241 missense probably benign
R8245:Dhrs2 UTSW 14 55241180 missense possibly damaging 0.94
R8296:Dhrs2 UTSW 14 55240471 missense probably damaging 1.00
R8324:Dhrs2 UTSW 14 55238764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACATGAAGAGCTCTGTGC -3'
(R):5'- GATACAGAGTTAAACACCAGGCTG -3'

Sequencing Primer
(F):5'- CTCTGTGCTTTTCTGGAAAGTC -3'
(R):5'- CACCAGGCTGTGTGATAGTTG -3'
Posted On2015-04-02