Incidental Mutation 'R3805:Ifit1'
ID274572
Institutional Source Beutler Lab
Gene Symbol Ifit1
Ensembl Gene ENSMUSG00000034459
Gene Nameinterferon-induced protein with tetratricopeptide repeats 1
SynonymsIfi56, ISG56
MMRRC Submission 040762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3805 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34640871-34650009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34648156 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 231 (I231V)
Ref Sequence ENSEMBL: ENSMUSP00000099888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102824]
Predicted Effect probably damaging
Transcript: ENSMUST00000102824
AA Change: I231V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099888
Gene: ENSMUSG00000034459
AA Change: I231V

DomainStartEndE-ValueType
TPR 52 85 4.8e1 SMART
TPR 92 125 6.92e1 SMART
TPR 138 171 1.2e1 SMART
low complexity region 210 221 N/A INTRINSIC
low complexity region 223 234 N/A INTRINSIC
TPR 242 275 4.93e1 SMART
TPR 329 362 3.89e1 SMART
TPR 426 459 1.45e-1 SMART
Meta Mutation Damage Score 0.1940 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered response to vesicular stomatitis virus (VSV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Aebp2 GCGGCC GCGGCCGGCC 6: 140,643,949 probably null Het
Ano5 T C 7: 51,576,650 F584L probably benign Het
Ap1b1 T A 11: 5,033,225 probably null Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc138 T C 10: 58,561,997 I553T possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Ctu1 T C 7: 43,676,673 L252P probably damaging Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Dnah1 A T 14: 31,294,763 M1599K possibly damaging Het
Eri2 A T 7: 119,786,008 C423* probably null Het
Fam169a G A 13: 97,097,684 V155I probably benign Het
Get4 G T 5: 139,252,531 V23F probably damaging Het
Hdac3 A G 18: 37,945,692 probably null Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Htt A G 5: 34,877,204 probably null Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Map7d1 A T 4: 126,237,291 probably null Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Naaladl1 A G 19: 6,114,865 T628A probably benign Het
Nlrp9a T A 7: 26,564,852 C643* probably null Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr1270 T G 2: 90,148,461 probably benign Het
Oxtr T C 6: 112,477,186 K39R probably benign Het
Ppp4r4 T A 12: 103,600,366 M24K probably damaging Het
Ppp6r2 T C 15: 89,265,639 F256L probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Rsph10b G A 5: 143,958,388 probably null Het
Slc9b2 T C 3: 135,324,588 L222P probably damaging Het
Speer4a C T 5: 26,035,084 E223K possibly damaging Het
St18 T A 1: 6,802,353 L104H probably damaging Het
Tmem184c C A 8: 77,596,875 D453Y unknown Het
Trpv1 A T 11: 73,253,053 N237I probably damaging Het
Vmn2r77 T A 7: 86,795,160 L7* probably null Het
Other mutations in Ifit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Ifit1 APN 19 34648133 missense possibly damaging 0.73
IGL01484:Ifit1 APN 19 34648843 missense probably damaging 0.99
IGL01505:Ifit1 APN 19 34648454 missense probably benign 0.38
IGL02663:Ifit1 APN 19 34640980 utr 5 prime probably benign
IGL03063:Ifit1 APN 19 34648004 missense possibly damaging 0.71
R0655:Ifit1 UTSW 19 34647647 missense probably damaging 1.00
R1524:Ifit1 UTSW 19 34647632 missense probably damaging 0.97
R1859:Ifit1 UTSW 19 34647544 missense probably benign 0.00
R4514:Ifit1 UTSW 19 34648513 nonsense probably null
R4714:Ifit1 UTSW 19 34648163 missense probably damaging 0.99
R5310:Ifit1 UTSW 19 34648804 missense probably benign
R5620:Ifit1 UTSW 19 34647838 missense probably damaging 1.00
R5787:Ifit1 UTSW 19 34647575 missense probably benign 0.29
R5964:Ifit1 UTSW 19 34648469 missense possibly damaging 0.76
R8230:Ifit1 UTSW 19 34647668 missense probably benign 0.00
R8249:Ifit1 UTSW 19 34640989 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACAACACTGGCTATGCAGTCG -3'
(R):5'- ACATTGTCCTGCCTTCTGGG -3'

Sequencing Primer
(F):5'- GTCGTAGCCTATCGCCAAGATTTAG -3'
(R):5'- CCTGTTTCGGGATGTCCTCAG -3'
Posted On2015-04-02