Incidental Mutation 'R3806:Fer1l4'
ID274579
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Namefer-1-like 4 (C. elegans)
Synonyms9130402C12Rik
MMRRC Submission 040763-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3806 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156019139-156052947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 156045683 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 531 (G531D)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
Predicted Effect probably damaging
Transcript: ENSMUST00000109611
AA Change: G531D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: G531D

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap9 A G 5: 3,954,410 N108S probably benign Het
Ankmy1 A G 1: 92,883,758 I636T possibly damaging Het
Bbs9 T A 9: 22,887,630 D851E probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc175 T C 12: 72,180,824 T62A possibly damaging Het
Clcnka T C 4: 141,387,290 E615G probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpxm2 C T 7: 132,080,091 M236I probably benign Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Fam131a G A 16: 20,695,858 V70M probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxl15 G C 19: 46,329,452 R191P possibly damaging Het
Fcrlb T C 1: 170,907,614 T315A probably benign Het
Gem C T 4: 11,705,965 Q18* probably null Het
Gm4788 T A 1: 139,753,035 K248N probably damaging Het
Hemk1 T A 9: 107,337,030 I68F probably damaging Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Ighv5-17 C A 12: 113,859,298 A68S probably benign Het
Ip6k3 T C 17: 27,145,000 H358R probably damaging Het
Itpr2 T C 6: 146,232,291 probably null Het
Kmt2a C T 9: 44,820,356 probably benign Het
Krt16 G T 11: 100,248,740 R51S unknown Het
Lamtor1 G A 7: 101,911,345 V156I probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Man1c1 A T 4: 134,703,351 L40Q probably damaging Het
Mgat4c A G 10: 102,388,360 N145S probably benign Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Muc5ac T C 7: 141,813,734 I2964T possibly damaging Het
Naip2 T A 13: 100,152,634 Q1196L possibly damaging Het
Nbas G A 12: 13,482,504 G1738S probably damaging Het
Nlrp5 A G 7: 23,404,846 E44G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr73 A G 2: 88,034,567 S191P possibly damaging Het
Otof T A 5: 30,386,499 probably null Het
Pcdha2 G A 18: 36,939,529 R71H probably benign Het
Pcdha2 G T 18: 36,941,691 E792* probably null Het
Pcnx A G 12: 81,950,137 T936A possibly damaging Het
Pofut2 T C 10: 77,260,806 Y122H probably damaging Het
Psg16 A G 7: 17,090,684 E131G probably benign Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Rab6a A G 7: 100,608,224 M1V probably null Het
Ripk3 T C 14: 55,786,268 R29G probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Ruvbl2 A G 7: 45,422,190 V423A possibly damaging Het
Scgb2b18 T G 7: 33,173,138 M81L probably benign Het
Slc24a2 A T 4: 87,227,784 L11H possibly damaging Het
Slc4a1 T C 11: 102,357,193 E325G probably benign Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Them6 A G 15: 74,721,518 D75G probably damaging Het
Tmem5 A T 10: 122,081,609 V333E possibly damaging Het
Tmem57 C T 4: 134,830,580 M207I probably benign Het
Tnrc18 G A 5: 142,787,274 A417V unknown Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zbtb22 C T 17: 33,916,946 probably benign Het
Zfp235 A G 7: 24,140,621 D225G probably benign Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 156019920 nonsense probably null
IGL01025:Fer1l4 APN 2 156052185 missense probably benign 0.41
IGL01103:Fer1l4 APN 2 156044441 critical splice donor site probably null
IGL01322:Fer1l4 APN 2 156020339 splice site probably null
IGL01391:Fer1l4 APN 2 156036456 missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 156048451 missense probably benign
IGL02267:Fer1l4 APN 2 156031252 missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 156019538 missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 156045428 missense probably benign 0.04
IGL02423:Fer1l4 APN 2 156052907 missense probably benign 0.04
IGL02596:Fer1l4 APN 2 156039132 missense probably benign
IGL02612:Fer1l4 APN 2 156047928 missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 156029715 missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 156045728 missense probably benign
IGL03035:Fer1l4 APN 2 156022606 missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 156039366 unclassified probably benign
IGL03201:Fer1l4 APN 2 156044730 missense probably benign 0.32
IGL03349:Fer1l4 APN 2 156044734 nonsense probably null
R0033:Fer1l4 UTSW 2 156024106 splice site probably benign
R0356:Fer1l4 UTSW 2 156024010 missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 156052886 missense probably benign 0.43
R0504:Fer1l4 UTSW 2 156052195 missense probably benign 0.36
R0731:Fer1l4 UTSW 2 156024070 missense probably benign 0.17
R0800:Fer1l4 UTSW 2 156045663 missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 156019313 missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 156049478 critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 156046249 missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 156045633 missense probably benign 0.00
R1657:Fer1l4 UTSW 2 156035598 missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 156029685 missense probably benign 0.14
R1816:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 156048274 missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 156039118 missense probably benign 0.00
R2219:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 156031764 missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 156052200 missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 156035048 missense probably benign 0.01
R3807:Fer1l4 UTSW 2 156045683 missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 156020389 missense probably benign 0.37
R4274:Fer1l4 UTSW 2 156020544 missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 156036639 missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 156047087 missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 156045623 missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4915:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4917:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4918:Fer1l4 UTSW 2 156031300 missense probably benign 0.41
R4941:Fer1l4 UTSW 2 156045089 missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 156031215 missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 156049466 missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 156037366 nonsense probably null
R5441:Fer1l4 UTSW 2 156023257 missense probably benign 0.00
R5555:Fer1l4 UTSW 2 156048189 missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 156051993 missense probably benign 0.01
R6125:Fer1l4 UTSW 2 156046987 missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 156048291 missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 156024982 missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 156046171 missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 156029268 missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 156024740 missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 156048250 missense probably benign 0.08
R6490:Fer1l4 UTSW 2 156047914 missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 156045470 missense probably benign 0.02
R6516:Fer1l4 UTSW 2 156035199 missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 156047865 critical splice donor site probably null
R6740:Fer1l4 UTSW 2 156031222 missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 156036730 missense probably benign 0.05
R7121:Fer1l4 UTSW 2 156044557 missense probably benign 0.13
R7132:Fer1l4 UTSW 2 156045626 missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 156020749 nonsense probably null
R7631:Fer1l4 UTSW 2 156048275 missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 156020431 missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 156048934 missense probably benign
R8021:Fer1l4 UTSW 2 156022591 missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 156024635 missense probably benign 0.03
R8171:Fer1l4 UTSW 2 156048231 missense probably benign 0.29
R8241:Fer1l4 UTSW 2 156049665 missense probably benign
R8245:Fer1l4 UTSW 2 156045014 critical splice donor site probably null
R8280:Fer1l4 UTSW 2 156049700 missense probably damaging 1.00
RF030:Fer1l4 UTSW 2 156045529 small deletion probably benign
X0063:Fer1l4 UTSW 2 156035011 missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 156048429 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTGCACTCGGAATCTCAGGC -3'
(R):5'- ACAAGTGTGTACAGTTCAGAACAG -3'

Sequencing Primer
(F):5'- GCTGTAAAATGCCAGCCG -3'
(R):5'- CAGAACAGTACCCATTTATTCTGTGC -3'
Posted On2015-04-02