Incidental Mutation 'R3806:Slc24a2'
ID 274584
Institutional Source Beutler Lab
Gene Symbol Slc24a2
Ensembl Gene ENSMUSG00000037996
Gene Name solute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms 6330417K15Rik
MMRRC Submission 040763-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R3806 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 86983124-87230477 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87227784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 11 (L11H)
Ref Sequence ENSEMBL: ENSMUSP00000102776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]
AlphaFold Q14BI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000044990
AA Change: L11H

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996
AA Change: L11H

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.7e-34 PFAM
low complexity region 445 457 N/A INTRINSIC
transmembrane domain 472 489 N/A INTRINSIC
Pfam:Na_Ca_ex 509 648 8.9e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107155
AA Change: L11H

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996
AA Change: L11H

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.6e-34 PFAM
low complexity region 428 440 N/A INTRINSIC
transmembrane domain 455 472 N/A INTRINSIC
Pfam:Na_Ca_ex 492 631 8.5e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107157
AA Change: L11H

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996
AA Change: L11H

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 7.2e-32 PFAM
transmembrane domain 476 493 N/A INTRINSIC
Pfam:Na_Ca_ex 503 654 4.4e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107158
AA Change: L11H

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: L11H

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 8e-32 PFAM
transmembrane domain 521 538 N/A INTRINSIC
Pfam:Na_Ca_ex 548 699 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155361
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap9 A G 5: 3,954,410 N108S probably benign Het
Ankmy1 A G 1: 92,883,758 I636T possibly damaging Het
Bbs9 T A 9: 22,887,630 D851E probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc175 T C 12: 72,180,824 T62A possibly damaging Het
Clcnka T C 4: 141,387,290 E615G probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpxm2 C T 7: 132,080,091 M236I probably benign Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Fam131a G A 16: 20,695,858 V70M probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxl15 G C 19: 46,329,452 R191P possibly damaging Het
Fcrlb T C 1: 170,907,614 T315A probably benign Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Gem C T 4: 11,705,965 Q18* probably null Het
Gm4788 T A 1: 139,753,035 K248N probably damaging Het
Hemk1 T A 9: 107,337,030 I68F probably damaging Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Ighv5-17 C A 12: 113,859,298 A68S probably benign Het
Ip6k3 T C 17: 27,145,000 H358R probably damaging Het
Itpr2 T C 6: 146,232,291 probably null Het
Kmt2a C T 9: 44,820,356 probably benign Het
Krt16 G T 11: 100,248,740 R51S unknown Het
Lamtor1 G A 7: 101,911,345 V156I probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Man1c1 A T 4: 134,703,351 L40Q probably damaging Het
Mgat4c A G 10: 102,388,360 N145S probably benign Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Muc5ac T C 7: 141,813,734 I2964T possibly damaging Het
Naip2 T A 13: 100,152,634 Q1196L possibly damaging Het
Nbas G A 12: 13,482,504 G1738S probably damaging Het
Nlrp5 A G 7: 23,404,846 E44G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr73 A G 2: 88,034,567 S191P possibly damaging Het
Otof T A 5: 30,386,499 probably null Het
Pcdha2 G A 18: 36,939,529 R71H probably benign Het
Pcdha2 G T 18: 36,941,691 E792* probably null Het
Pcnx A G 12: 81,950,137 T936A possibly damaging Het
Pofut2 T C 10: 77,260,806 Y122H probably damaging Het
Psg16 A G 7: 17,090,684 E131G probably benign Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Rab6a A G 7: 100,608,224 M1V probably null Het
Ripk3 T C 14: 55,786,268 R29G probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Ruvbl2 A G 7: 45,422,190 V423A possibly damaging Het
Scgb2b18 T G 7: 33,173,138 M81L probably benign Het
Slc4a1 T C 11: 102,357,193 E325G probably benign Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Them6 A G 15: 74,721,518 D75G probably damaging Het
Tmem5 A T 10: 122,081,609 V333E possibly damaging Het
Tmem57 C T 4: 134,830,580 M207I probably benign Het
Tnrc18 G A 5: 142,787,274 A417V unknown Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zbtb22 C T 17: 33,916,946 probably benign Het
Zfp235 A G 7: 24,140,621 D225G probably benign Het
Other mutations in Slc24a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc24a2 APN 4 87227796 missense probably benign 0.01
IGL02080:Slc24a2 APN 4 87227146 missense probably damaging 1.00
IGL03121:Slc24a2 APN 4 87226906 missense probably benign 0.00
G1patch:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
PIT4403001:Slc24a2 UTSW 4 87032286 missense probably benign 0.45
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0372:Slc24a2 UTSW 4 87227292 missense probably damaging 1.00
R1034:Slc24a2 UTSW 4 87032275 missense probably damaging 0.99
R1577:Slc24a2 UTSW 4 86991411 missense probably damaging 1.00
R1776:Slc24a2 UTSW 4 87176289 missense probably benign 0.01
R1955:Slc24a2 UTSW 4 87073244 missense probably damaging 1.00
R2043:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R2091:Slc24a2 UTSW 4 87011646 missense probably damaging 1.00
R2114:Slc24a2 UTSW 4 86991355 missense probably benign 0.07
R2921:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2922:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2924:Slc24a2 UTSW 4 87011724 missense probably benign 0.34
R3933:Slc24a2 UTSW 4 87176185 missense probably benign
R4052:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4207:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4466:Slc24a2 UTSW 4 87227862 utr 5 prime probably benign
R4531:Slc24a2 UTSW 4 86991478 missense possibly damaging 0.91
R4561:Slc24a2 UTSW 4 87227397 missense probably damaging 1.00
R4808:Slc24a2 UTSW 4 87032238 missense probably benign 0.01
R4884:Slc24a2 UTSW 4 86991508 missense probably damaging 0.98
R4893:Slc24a2 UTSW 4 87226908 missense probably damaging 0.98
R4936:Slc24a2 UTSW 4 87227347 missense probably damaging 1.00
R5035:Slc24a2 UTSW 4 87011706 missense possibly damaging 0.48
R5171:Slc24a2 UTSW 4 86996634 missense probably benign 0.40
R5369:Slc24a2 UTSW 4 86991388 missense probably damaging 0.99
R5924:Slc24a2 UTSW 4 87011588 splice site probably null
R6046:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R6725:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
R6756:Slc24a2 UTSW 4 87176292 missense probably benign
R7087:Slc24a2 UTSW 4 86991219 splice site probably null
R7804:Slc24a2 UTSW 4 86991537 missense probably damaging 1.00
R8003:Slc24a2 UTSW 4 87176315 missense probably benign 0.04
R8058:Slc24a2 UTSW 4 86991513 missense probably damaging 1.00
R8428:Slc24a2 UTSW 4 87227100 missense probably damaging 1.00
R8529:Slc24a2 UTSW 4 87028280 missense possibly damaging 0.51
R9656:Slc24a2 UTSW 4 87049907 missense probably damaging 1.00
X0003:Slc24a2 UTSW 4 86991447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTGACGGTGACCCTGTG -3'
(R):5'- GAGCTATTTTCCCCGTGAAGAG -3'

Sequencing Primer
(F):5'- TGGGGCCACTCATATCACTG -3'
(R):5'- TTTTCCCCGTGAAGAGTAAAGATCCC -3'
Posted On 2015-04-02