Incidental Mutation 'R3806:Krt16'
ID274612
Institutional Source Beutler Lab
Gene Symbol Krt16
Ensembl Gene ENSMUSG00000053797
Gene Namekeratin 16
SynonymsKrt1-16, K16
MMRRC Submission 040763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3806 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100246091-100248902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100248740 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 51 (R51S)
Ref Sequence ENSEMBL: ENSMUSP00000007280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007280]
Predicted Effect unknown
Transcript: ENSMUST00000007280
AA Change: R51S
SMART Domains Protein: ENSMUSP00000007280
Gene: ENSMUSG00000053797
AA Change: R51S

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 112 423 8.41e-170 SMART
low complexity region 454 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The encoded protein is a cytokeratin and acts as an innate immune system effector, promoting the inflammatory response upon breach of the skin barrier. Defects in this gene are a cause of pachyonychia congenita. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal and postnatal lethality, decreased body weight, abnormal tongue epithelium and hyperkertotic calluses in areas of physical pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap9 A G 5: 3,954,410 N108S probably benign Het
Ankmy1 A G 1: 92,883,758 I636T possibly damaging Het
Bbs9 T A 9: 22,887,630 D851E probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc175 T C 12: 72,180,824 T62A possibly damaging Het
Clcnka T C 4: 141,387,290 E615G probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpxm2 C T 7: 132,080,091 M236I probably benign Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Fam131a G A 16: 20,695,858 V70M probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxl15 G C 19: 46,329,452 R191P possibly damaging Het
Fcrlb T C 1: 170,907,614 T315A probably benign Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Gem C T 4: 11,705,965 Q18* probably null Het
Gm4788 T A 1: 139,753,035 K248N probably damaging Het
Hemk1 T A 9: 107,337,030 I68F probably damaging Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Ighv5-17 C A 12: 113,859,298 A68S probably benign Het
Ip6k3 T C 17: 27,145,000 H358R probably damaging Het
Itpr2 T C 6: 146,232,291 probably null Het
Kmt2a C T 9: 44,820,356 probably benign Het
Lamtor1 G A 7: 101,911,345 V156I probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Man1c1 A T 4: 134,703,351 L40Q probably damaging Het
Mgat4c A G 10: 102,388,360 N145S probably benign Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Muc5ac T C 7: 141,813,734 I2964T possibly damaging Het
Naip2 T A 13: 100,152,634 Q1196L possibly damaging Het
Nbas G A 12: 13,482,504 G1738S probably damaging Het
Nlrp5 A G 7: 23,404,846 E44G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr73 A G 2: 88,034,567 S191P possibly damaging Het
Otof T A 5: 30,386,499 probably null Het
Pcdha2 G A 18: 36,939,529 R71H probably benign Het
Pcdha2 G T 18: 36,941,691 E792* probably null Het
Pcnx A G 12: 81,950,137 T936A possibly damaging Het
Pofut2 T C 10: 77,260,806 Y122H probably damaging Het
Psg16 A G 7: 17,090,684 E131G probably benign Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Rab6a A G 7: 100,608,224 M1V probably null Het
Ripk3 T C 14: 55,786,268 R29G probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Ruvbl2 A G 7: 45,422,190 V423A possibly damaging Het
Scgb2b18 T G 7: 33,173,138 M81L probably benign Het
Slc24a2 A T 4: 87,227,784 L11H possibly damaging Het
Slc4a1 T C 11: 102,357,193 E325G probably benign Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Them6 A G 15: 74,721,518 D75G probably damaging Het
Tmem5 A T 10: 122,081,609 V333E possibly damaging Het
Tmem57 C T 4: 134,830,580 M207I probably benign Het
Tnrc18 G A 5: 142,787,274 A417V unknown Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zbtb22 C T 17: 33,916,946 probably benign Het
Zfp235 A G 7: 24,140,621 D225G probably benign Het
Other mutations in Krt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Krt16 APN 11 100248717 nonsense probably null
IGL01794:Krt16 APN 11 100247905 missense probably benign 0.00
IGL01795:Krt16 APN 11 100247724 splice site probably benign
IGL02221:Krt16 APN 11 100246336 splice site probably benign
IGL02243:Krt16 APN 11 100246336 splice site probably benign
IGL02410:Krt16 APN 11 100246336 splice site probably benign
IGL02451:Krt16 APN 11 100246336 splice site probably benign
IGL02457:Krt16 APN 11 100246336 splice site probably benign
IGL02512:Krt16 APN 11 100246336 splice site probably benign
IGL02745:Krt16 APN 11 100246336 splice site probably benign
IGL02867:Krt16 APN 11 100247576 missense probably damaging 1.00
PIT4131001:Krt16 UTSW 11 100248749 missense unknown
PIT4472001:Krt16 UTSW 11 100247906 missense probably benign 0.04
R0268:Krt16 UTSW 11 100246525 splice site probably benign
R0709:Krt16 UTSW 11 100246454 splice site probably benign
R1560:Krt16 UTSW 11 100246649 missense probably damaging 1.00
R1728:Krt16 UTSW 11 100247707 missense probably damaging 1.00
R1996:Krt16 UTSW 11 100248788 missense unknown
R2927:Krt16 UTSW 11 100248799 missense unknown
R3907:Krt16 UTSW 11 100247163 missense possibly damaging 0.83
R5133:Krt16 UTSW 11 100247631 missense probably damaging 0.99
R5412:Krt16 UTSW 11 100246767 missense probably damaging 1.00
R5723:Krt16 UTSW 11 100248446 missense probably damaging 0.99
R6270:Krt16 UTSW 11 100247203 missense possibly damaging 0.51
R6368:Krt16 UTSW 11 100246676 missense probably damaging 1.00
R7191:Krt16 UTSW 11 100246658 missense probably damaging 1.00
R7314:Krt16 UTSW 11 100247869 missense probably damaging 1.00
R7446:Krt16 UTSW 11 100246784 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTTTGATCTCAGTGGGCCG -3'
(R):5'- TCTCCAGTTCCTCAGCATGG -3'

Sequencing Primer
(F):5'- CATTGAGGTTCTGCATGGTCAC -3'
(R):5'- AGTTCCTCAGCATGGCCACC -3'
Posted On2015-04-02