Incidental Mutation 'R3806:Nolc1'
ID274629
Institutional Source Beutler Lab
Gene Symbol Nolc1
Ensembl Gene ENSMUSG00000015176
Gene Namenucleolar and coiled-body phosphoprotein 1
SynonymsNOPP140, 3230402K17Rik, P130
MMRRC Submission 040763-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3806 (G1)
Quality Score217
Status Not validated
Chromosome19
Chromosomal Location46075863-46085530 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CCAGCAGCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGCAGCAGCAGCAGC at 46081352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165017] [ENSMUST00000223728] [ENSMUST00000223741] [ENSMUST00000224490] [ENSMUST00000225780]
Predicted Effect probably benign
Transcript: ENSMUST00000165017
SMART Domains Protein: ENSMUSP00000128331
Gene: ENSMUSG00000015176

DomainStartEndE-ValueType
LisH 10 42 2.3e-2 SMART
low complexity region 76 100 N/A INTRINSIC
low complexity region 123 187 N/A INTRINSIC
low complexity region 189 210 N/A INTRINSIC
low complexity region 224 272 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 329 342 N/A INTRINSIC
low complexity region 353 383 N/A INTRINSIC
low complexity region 429 470 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 509 538 N/A INTRINSIC
low complexity region 558 579 N/A INTRINSIC
Pfam:SRP40_C 627 699 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223683
Predicted Effect probably benign
Transcript: ENSMUST00000223728
Predicted Effect probably benign
Transcript: ENSMUST00000223741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224434
Predicted Effect probably benign
Transcript: ENSMUST00000224490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225758
Predicted Effect probably benign
Transcript: ENSMUST00000225780
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap9 A G 5: 3,954,410 N108S probably benign Het
Ankmy1 A G 1: 92,883,758 I636T possibly damaging Het
Bbs9 T A 9: 22,887,630 D851E probably damaging Het
Bicd1 T A 6: 149,518,991 L780M probably damaging Het
Ccdc175 T C 12: 72,180,824 T62A possibly damaging Het
Clcnka T C 4: 141,387,290 E615G probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cpxm2 C T 7: 132,080,091 M236I probably benign Het
Dhrs2 A T 14: 55,234,748 N32I probably benign Het
Fam131a G A 16: 20,695,858 V70M probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fbxl15 G C 19: 46,329,452 R191P possibly damaging Het
Fcrlb T C 1: 170,907,614 T315A probably benign Het
Fer1l4 C T 2: 156,045,683 G531D probably damaging Het
Gem C T 4: 11,705,965 Q18* probably null Het
Gm4788 T A 1: 139,753,035 K248N probably damaging Het
Hemk1 T A 9: 107,337,030 I68F probably damaging Het
Herc3 C A 6: 58,916,850 H970Q probably damaging Het
Ighv5-17 C A 12: 113,859,298 A68S probably benign Het
Ip6k3 T C 17: 27,145,000 H358R probably damaging Het
Itpr2 T C 6: 146,232,291 probably null Het
Kmt2a C T 9: 44,820,356 probably benign Het
Krt16 G T 11: 100,248,740 R51S unknown Het
Lamtor1 G A 7: 101,911,345 V156I probably damaging Het
Lingo4 A G 3: 94,402,100 D115G probably damaging Het
Lrrc7 T C 3: 158,185,493 I346V probably benign Het
Man1c1 A T 4: 134,703,351 L40Q probably damaging Het
Mgat4c A G 10: 102,388,360 N145S probably benign Het
Morf4l1 A G 9: 90,095,143 S203P probably benign Het
Muc5ac T C 7: 141,813,734 I2964T possibly damaging Het
Naip2 T A 13: 100,152,634 Q1196L possibly damaging Het
Nbas G A 12: 13,482,504 G1738S probably damaging Het
Nlrp5 A G 7: 23,404,846 E44G probably benign Het
Olfr1187-ps1 A T 2: 88,540,356 noncoding transcript Het
Olfr73 A G 2: 88,034,567 S191P possibly damaging Het
Otof T A 5: 30,386,499 probably null Het
Pcdha2 G A 18: 36,939,529 R71H probably benign Het
Pcdha2 G T 18: 36,941,691 E792* probably null Het
Pcnx A G 12: 81,950,137 T936A possibly damaging Het
Pofut2 T C 10: 77,260,806 Y122H probably damaging Het
Psg16 A G 7: 17,090,684 E131G probably benign Het
Psmd12 T G 11: 107,495,765 D387E probably benign Het
Rab6a A G 7: 100,608,224 M1V probably null Het
Ripk3 T C 14: 55,786,268 R29G probably benign Het
Robo4 A T 9: 37,404,438 D329V possibly damaging Het
Ruvbl2 A G 7: 45,422,190 V423A possibly damaging Het
Scgb2b18 T G 7: 33,173,138 M81L probably benign Het
Slc24a2 A T 4: 87,227,784 L11H possibly damaging Het
Slc4a1 T C 11: 102,357,193 E325G probably benign Het
Syt16 A G 12: 74,229,398 E212G possibly damaging Het
Them6 A G 15: 74,721,518 D75G probably damaging Het
Tmem5 A T 10: 122,081,609 V333E possibly damaging Het
Tmem57 C T 4: 134,830,580 M207I probably benign Het
Tnrc18 G A 5: 142,787,274 A417V unknown Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zbtb22 C T 17: 33,916,946 probably benign Het
Zfp235 A G 7: 24,140,621 D225G probably benign Het
Other mutations in Nolc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Nolc1 APN 19 46083029 unclassified probably benign
FR4976:Nolc1 UTSW 19 46081356 small insertion probably benign
FR4976:Nolc1 UTSW 19 46081375 small insertion probably benign
R0106:Nolc1 UTSW 19 46080089 splice site probably benign
R0121:Nolc1 UTSW 19 46081378 unclassified probably benign
R0140:Nolc1 UTSW 19 46081378 unclassified probably benign
R0501:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R0513:Nolc1 UTSW 19 46084159 missense probably damaging 1.00
R0676:Nolc1 UTSW 19 46080089 splice site probably benign
R1553:Nolc1 UTSW 19 46081375 small insertion probably benign
R1642:Nolc1 UTSW 19 46079022 critical splice donor site probably null
R1698:Nolc1 UTSW 19 46081431 splice site probably null
R2067:Nolc1 UTSW 19 46083607 missense probably damaging 1.00
R2113:Nolc1 UTSW 19 46081359 small insertion probably benign
R2113:Nolc1 UTSW 19 46081361 small insertion probably benign
R2300:Nolc1 UTSW 19 46081359 small insertion probably benign
R2300:Nolc1 UTSW 19 46081368 small insertion probably benign
R2895:Nolc1 UTSW 19 46081352 small insertion probably benign
R2999:Nolc1 UTSW 19 46083155 small deletion probably benign
R3737:Nolc1 UTSW 19 46081353 small insertion probably benign
R3737:Nolc1 UTSW 19 46081370 small insertion probably benign
R3737:Nolc1 UTSW 19 46081377 small insertion probably benign
R3747:Nolc1 UTSW 19 46081356 small insertion probably benign
R3807:Nolc1 UTSW 19 46081352 small insertion probably benign
R3807:Nolc1 UTSW 19 46081359 small insertion probably benign
R3807:Nolc1 UTSW 19 46081371 small insertion probably benign
R4035:Nolc1 UTSW 19 46081358 small insertion probably benign
R4619:Nolc1 UTSW 19 46083520 missense probably damaging 1.00
R4856:Nolc1 UTSW 19 46083155 small deletion probably benign
R4999:Nolc1 UTSW 19 46078920 missense probably damaging 1.00
R5103:Nolc1 UTSW 19 46081664 nonsense probably null
R5559:Nolc1 UTSW 19 46083155 small deletion probably benign
R5837:Nolc1 UTSW 19 46083183 unclassified probably benign
R6457:Nolc1 UTSW 19 46083070 unclassified probably benign
R7467:Nolc1 UTSW 19 46082334 missense unknown
R7497:Nolc1 UTSW 19 46082818 missense probably benign 0.23
R8011:Nolc1 UTSW 19 46081584 missense unknown
R8806:Nolc1 UTSW 19 46083032 missense unknown
RF027:Nolc1 UTSW 19 46081363 small insertion probably benign
RF031:Nolc1 UTSW 19 46081371 small insertion probably benign
RF034:Nolc1 UTSW 19 46081371 small insertion probably benign
RF040:Nolc1 UTSW 19 46081363 small insertion probably benign
RF044:Nolc1 UTSW 19 46081371 small insertion probably benign
X0050:Nolc1 UTSW 19 46081352 small deletion probably benign
Y5377:Nolc1 UTSW 19 46081369 small insertion probably benign
Y5379:Nolc1 UTSW 19 46081359 small insertion probably benign
Z1088:Nolc1 UTSW 19 46083098 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGGTCATCCTTTACCTGCTAAG -3'
(R):5'- TACTTTCACTGGGGCCTTGG -3'

Sequencing Primer
(F):5'- TGCTAAGCCATCCCACCTG -3'
(R):5'- TGGTACAGTCTTCATTGGAGAG -3'
Posted On2015-04-02