Incidental Mutation 'R3765:Prg4'
ID 274632
Institutional Source Beutler Lab
Gene Symbol Prg4
Ensembl Gene ENSMUSG00000006014
Gene Name proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms MSF, SZP, lubricin, DOL54
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 150325163-150341916 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 150327122 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 898 (S898L)
Ref Sequence ENSEMBL: ENSMUSP00000107533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000119161] [ENSMUST00000124484] [ENSMUST00000124973] [ENSMUST00000164600] [ENSMUST00000162367] [ENSMUST00000161611] [ENSMUST00000161320]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006171
AA Change: S309L

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014
AA Change: S309L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000111901
AA Change: S851L
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014
AA Change: S851L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111902
AA Change: S898L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014
AA Change: S898L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119161
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124484
SMART Domains Protein: ENSMUSP00000121991
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
low complexity region 50 64 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124973
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138718
Predicted Effect unknown
Transcript: ENSMUST00000164600
AA Change: S1107L
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014
AA Change: S1107L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162367
AA Change: S309L

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014
AA Change: S309L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000161611
AA Change: S1107L
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014
AA Change: S1107L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152967
Predicted Effect probably benign
Transcript: ENSMUST00000161320
SMART Domains Protein: ENSMUSP00000124801
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 3.83e-15 SMART
low complexity region 69 83 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
low complexity region 148 179 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Aging homozygous null mice develop a hopping gait, irregular endochondral growth plates, altered cartilage surface, camptodactyly, progressive synovial hyperplasia and, ultimately, joint failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Ccdc185 T A 1: 182,575,117 (GRCm39) H524L possibly damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Frk A G 10: 34,360,001 (GRCm39) M1V probably null Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prmt6 C A 3: 110,157,510 (GRCm39) E260* probably null Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Sbf2 A G 7: 109,974,788 (GRCm39) V783A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Setd2 T C 9: 110,423,314 (GRCm39) L345P probably damaging Het
Slc18b1 A G 10: 23,674,647 (GRCm39) D34G probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Slx4 A G 16: 3,798,850 (GRCm39) V1357A probably damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Tns3 G A 11: 8,401,133 (GRCm39) A1055V probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfhx3 A G 8: 109,519,394 (GRCm39) N172S probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Prg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Prg4 APN 1 150,327,671 (GRCm39) missense probably damaging 0.99
IGL02033:Prg4 APN 1 150,331,619 (GRCm39) intron probably benign
IGL02154:Prg4 APN 1 150,330,613 (GRCm39) intron probably benign
IGL03111:Prg4 APN 1 150,327,653 (GRCm39) missense probably benign 0.06
IGL03177:Prg4 APN 1 150,331,354 (GRCm39) intron probably benign
IGL03260:Prg4 APN 1 150,331,378 (GRCm39) intron probably benign
IGL03281:Prg4 APN 1 150,325,839 (GRCm39) splice site probably benign
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0196:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
R0233:Prg4 UTSW 1 150,329,298 (GRCm39) splice site probably benign
R0255:Prg4 UTSW 1 150,331,558 (GRCm39) intron probably benign
R0616:Prg4 UTSW 1 150,336,462 (GRCm39) missense probably damaging 1.00
R1016:Prg4 UTSW 1 150,330,442 (GRCm39) intron probably benign
R1826:Prg4 UTSW 1 150,327,760 (GRCm39) missense probably benign 0.09
R1862:Prg4 UTSW 1 150,336,420 (GRCm39) missense probably damaging 0.99
R1863:Prg4 UTSW 1 150,336,420 (GRCm39) missense probably damaging 0.99
R1922:Prg4 UTSW 1 150,325,750 (GRCm39) nonsense probably null
R1940:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R3855:Prg4 UTSW 1 150,327,751 (GRCm39) missense probably damaging 1.00
R3894:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3895:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3912:Prg4 UTSW 1 150,327,619 (GRCm39) missense probably damaging 1.00
R3935:Prg4 UTSW 1 150,333,908 (GRCm39) missense possibly damaging 0.68
R4050:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R4475:Prg4 UTSW 1 150,330,610 (GRCm39) intron probably benign
R4794:Prg4 UTSW 1 150,330,297 (GRCm39) intron probably benign
R4910:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4911:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4993:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R5378:Prg4 UTSW 1 150,330,977 (GRCm39) intron probably benign
R5381:Prg4 UTSW 1 150,330,204 (GRCm39) intron probably benign
R5452:Prg4 UTSW 1 150,331,519 (GRCm39) intron probably benign
R5870:Prg4 UTSW 1 150,331,300 (GRCm39) nonsense probably null
R5888:Prg4 UTSW 1 150,328,101 (GRCm39) missense probably damaging 1.00
R5929:Prg4 UTSW 1 150,329,880 (GRCm39) missense probably benign 0.01
R6058:Prg4 UTSW 1 150,327,197 (GRCm39) missense probably damaging 0.99
R6059:Prg4 UTSW 1 150,325,748 (GRCm39) missense possibly damaging 0.67
R6232:Prg4 UTSW 1 150,331,567 (GRCm39) intron probably benign
R6272:Prg4 UTSW 1 150,330,517 (GRCm39) intron probably benign
R6459:Prg4 UTSW 1 150,330,052 (GRCm39) intron probably benign
R6659:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R6663:Prg4 UTSW 1 150,330,852 (GRCm39) intron probably benign
R6882:Prg4 UTSW 1 150,329,246 (GRCm39) missense probably damaging 1.00
R6970:Prg4 UTSW 1 150,331,657 (GRCm39) intron probably benign
R7078:Prg4 UTSW 1 150,334,014 (GRCm39) missense possibly damaging 0.91
R7102:Prg4 UTSW 1 150,328,005 (GRCm39) missense probably damaging 1.00
R7264:Prg4 UTSW 1 150,329,818 (GRCm39) missense not run
R7487:Prg4 UTSW 1 150,331,656 (GRCm39) missense unknown
R7531:Prg4 UTSW 1 150,330,786 (GRCm39) missense unknown
R7651:Prg4 UTSW 1 150,330,696 (GRCm39) missense unknown
R7701:Prg4 UTSW 1 150,333,293 (GRCm39) missense possibly damaging 0.53
R8072:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R8168:Prg4 UTSW 1 150,331,601 (GRCm39) missense unknown
R8248:Prg4 UTSW 1 150,330,877 (GRCm39) missense unknown
R8436:Prg4 UTSW 1 150,331,318 (GRCm39) missense unknown
R8460:Prg4 UTSW 1 150,331,692 (GRCm39) missense possibly damaging 0.83
R8514:Prg4 UTSW 1 150,330,396 (GRCm39) missense unknown
R8904:Prg4 UTSW 1 150,331,810 (GRCm39) missense possibly damaging 0.83
R9072:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9073:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9274:Prg4 UTSW 1 150,331,924 (GRCm39) missense possibly damaging 0.53
R9337:Prg4 UTSW 1 150,327,116 (GRCm39) missense probably damaging 1.00
R9488:Prg4 UTSW 1 150,327,024 (GRCm39) missense probably benign
R9613:Prg4 UTSW 1 150,331,660 (GRCm39) missense unknown
R9670:Prg4 UTSW 1 150,326,618 (GRCm39) missense probably benign 0.01
X0024:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- GGTTAGTACTTTCATGGCCAATAC -3'
(R):5'- TCAAGAACGGCATTAAAAGTAGCC -3'

Sequencing Primer
(F):5'- AGAAACTCTCATGGGCAC -3'
(R):5'- CTGTGTAACAGGTGGCAA -3'
Posted On 2015-04-02