Incidental Mutation 'R3765:Ccdc185'
ID 274634
Institutional Source Beutler Lab
Gene Symbol Ccdc185
Ensembl Gene ENSMUSG00000043429
Gene Name coiled-coil domain containing 185
Synonyms 4922505E12Rik
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R3765 (G1)
Quality Score 220
Status Not validated
Chromosome 1
Chromosomal Location 182747126-182749180 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 182747552 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 524 (H524L)
Ref Sequence ENSEMBL: ENSMUSP00000095053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060041]
AlphaFold Q3V118
Predicted Effect possibly damaging
Transcript: ENSMUST00000060041
AA Change: H524L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095053
Gene: ENSMUSG00000043429
AA Change: H524L

DomainStartEndE-ValueType
low complexity region 117 131 N/A INTRINSIC
Pfam:DUF4659 239 618 3.2e-119 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Ccdc185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Ccdc185 APN 1 182747423 missense possibly damaging 0.85
IGL01121:Ccdc185 APN 1 182748657 missense probably benign 0.33
IGL01143:Ccdc185 APN 1 182747852 missense probably damaging 0.98
IGL01721:Ccdc185 APN 1 182748978 missense possibly damaging 0.53
IGL01941:Ccdc185 APN 1 182748204 missense probably benign 0.32
IGL01945:Ccdc185 APN 1 182748876 missense probably benign 0.33
IGL03333:Ccdc185 APN 1 182748833 missense probably damaging 1.00
Ratas UTSW 1 182749017 missense possibly damaging 0.73
Ratones UTSW 1 182747520 missense possibly damaging 0.52
R0486:Ccdc185 UTSW 1 182747859 missense possibly damaging 0.86
R0653:Ccdc185 UTSW 1 182747564 missense possibly damaging 0.52
R1263:Ccdc185 UTSW 1 182747353 nonsense probably null
R1450:Ccdc185 UTSW 1 182747564 missense possibly damaging 0.71
R1464:Ccdc185 UTSW 1 182748698 missense probably benign
R1464:Ccdc185 UTSW 1 182748698 missense probably benign
R2146:Ccdc185 UTSW 1 182747520 missense possibly damaging 0.52
R3409:Ccdc185 UTSW 1 182748748 missense possibly damaging 0.73
R3410:Ccdc185 UTSW 1 182748748 missense possibly damaging 0.73
R4012:Ccdc185 UTSW 1 182748888 missense possibly damaging 0.91
R4953:Ccdc185 UTSW 1 182749017 missense possibly damaging 0.73
R5096:Ccdc185 UTSW 1 182748789 missense possibly damaging 0.73
R5166:Ccdc185 UTSW 1 182748999 nonsense probably null
R5300:Ccdc185 UTSW 1 182748080 missense probably benign 0.00
R5504:Ccdc185 UTSW 1 182747627 missense probably damaging 0.97
R5863:Ccdc185 UTSW 1 182748557 missense possibly damaging 0.53
R5928:Ccdc185 UTSW 1 182747482 missense probably benign 0.00
R7127:Ccdc185 UTSW 1 182748856 missense possibly damaging 0.70
R8125:Ccdc185 UTSW 1 182747270 missense probably benign 0.10
R8197:Ccdc185 UTSW 1 182748759 missense possibly damaging 0.93
R9248:Ccdc185 UTSW 1 182748656 missense probably benign 0.33
Z1177:Ccdc185 UTSW 1 182748514 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GGTCATCTGCGCTAACCTTTG -3'
(R):5'- GAACTCCTCAGGAAGCTGTC -3'

Sequencing Primer
(F):5'- AACCTTTGTTCCTTCTTCTTGATGG -3'
(R):5'- AGCAGAGTTCCCAGAGCTC -3'
Posted On 2015-04-02