Incidental Mutation 'R3765:Ccdc185'
ID 274634
Institutional Source Beutler Lab
Gene Symbol Ccdc185
Ensembl Gene ENSMUSG00000043429
Gene Name coiled-coil domain containing 185
Synonyms 4922505E12Rik
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R3765 (G1)
Quality Score 220
Status Not validated
Chromosome 1
Chromosomal Location 182574691-182576745 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 182575117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 524 (H524L)
Ref Sequence ENSEMBL: ENSMUSP00000095053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060041]
AlphaFold Q3V118
Predicted Effect possibly damaging
Transcript: ENSMUST00000060041
AA Change: H524L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095053
Gene: ENSMUSG00000043429
AA Change: H524L

DomainStartEndE-ValueType
low complexity region 117 131 N/A INTRINSIC
Pfam:DUF4659 239 618 3.2e-119 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Frk A G 10: 34,360,001 (GRCm39) M1V probably null Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prg4 G A 1: 150,327,122 (GRCm39) S898L probably damaging Het
Prmt6 C A 3: 110,157,510 (GRCm39) E260* probably null Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Sbf2 A G 7: 109,974,788 (GRCm39) V783A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Setd2 T C 9: 110,423,314 (GRCm39) L345P probably damaging Het
Slc18b1 A G 10: 23,674,647 (GRCm39) D34G probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Slx4 A G 16: 3,798,850 (GRCm39) V1357A probably damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Tns3 G A 11: 8,401,133 (GRCm39) A1055V probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfhx3 A G 8: 109,519,394 (GRCm39) N172S probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Ccdc185
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Ccdc185 APN 1 182,574,988 (GRCm39) missense possibly damaging 0.85
IGL01121:Ccdc185 APN 1 182,576,222 (GRCm39) missense probably benign 0.33
IGL01143:Ccdc185 APN 1 182,575,417 (GRCm39) missense probably damaging 0.98
IGL01721:Ccdc185 APN 1 182,576,543 (GRCm39) missense possibly damaging 0.53
IGL01941:Ccdc185 APN 1 182,575,769 (GRCm39) missense probably benign 0.32
IGL01945:Ccdc185 APN 1 182,576,441 (GRCm39) missense probably benign 0.33
IGL03333:Ccdc185 APN 1 182,576,398 (GRCm39) missense probably damaging 1.00
Ratas UTSW 1 182,576,582 (GRCm39) missense possibly damaging 0.73
Ratones UTSW 1 182,575,085 (GRCm39) missense possibly damaging 0.52
R0486:Ccdc185 UTSW 1 182,575,424 (GRCm39) missense possibly damaging 0.86
R0653:Ccdc185 UTSW 1 182,575,129 (GRCm39) missense possibly damaging 0.52
R1263:Ccdc185 UTSW 1 182,574,918 (GRCm39) nonsense probably null
R1450:Ccdc185 UTSW 1 182,575,129 (GRCm39) missense possibly damaging 0.71
R1464:Ccdc185 UTSW 1 182,576,263 (GRCm39) missense probably benign
R1464:Ccdc185 UTSW 1 182,576,263 (GRCm39) missense probably benign
R2146:Ccdc185 UTSW 1 182,575,085 (GRCm39) missense possibly damaging 0.52
R3409:Ccdc185 UTSW 1 182,576,313 (GRCm39) missense possibly damaging 0.73
R3410:Ccdc185 UTSW 1 182,576,313 (GRCm39) missense possibly damaging 0.73
R4012:Ccdc185 UTSW 1 182,576,453 (GRCm39) missense possibly damaging 0.91
R4953:Ccdc185 UTSW 1 182,576,582 (GRCm39) missense possibly damaging 0.73
R5096:Ccdc185 UTSW 1 182,576,354 (GRCm39) missense possibly damaging 0.73
R5166:Ccdc185 UTSW 1 182,576,564 (GRCm39) nonsense probably null
R5300:Ccdc185 UTSW 1 182,575,645 (GRCm39) missense probably benign 0.00
R5504:Ccdc185 UTSW 1 182,575,192 (GRCm39) missense probably damaging 0.97
R5863:Ccdc185 UTSW 1 182,576,122 (GRCm39) missense possibly damaging 0.53
R5928:Ccdc185 UTSW 1 182,575,047 (GRCm39) missense probably benign 0.00
R7127:Ccdc185 UTSW 1 182,576,421 (GRCm39) missense possibly damaging 0.70
R8125:Ccdc185 UTSW 1 182,574,835 (GRCm39) missense probably benign 0.10
R8197:Ccdc185 UTSW 1 182,576,324 (GRCm39) missense possibly damaging 0.93
R9248:Ccdc185 UTSW 1 182,576,221 (GRCm39) missense probably benign 0.33
Z1177:Ccdc185 UTSW 1 182,576,079 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GGTCATCTGCGCTAACCTTTG -3'
(R):5'- GAACTCCTCAGGAAGCTGTC -3'

Sequencing Primer
(F):5'- AACCTTTGTTCCTTCTTCTTGATGG -3'
(R):5'- AGCAGAGTTCCCAGAGCTC -3'
Posted On 2015-04-02