Incidental Mutation 'R3765:Arl6ip6'
ID 274635
Institutional Source Beutler Lab
Gene Symbol Arl6ip6
Ensembl Gene ENSMUSG00000026960
Gene Name ADP-ribosylation factor-like 6 interacting protein 6
Synonyms Aip-6, 2310057C01Rik, 2610529A11Rik
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 53191726-53219220 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53192231 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 37 (W37R)
Ref Sequence ENSEMBL: ENSMUSP00000028336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028336] [ENSMUST00000076313] [ENSMUST00000125243] [ENSMUST00000209364] [ENSMUST00000209508] [ENSMUST00000210789] [ENSMUST00000211102] [ENSMUST00000211712]
AlphaFold Q8BH07
Predicted Effect probably damaging
Transcript: ENSMUST00000028336
AA Change: W37R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028336
Gene: ENSMUSG00000026960
AA Change: W37R

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
transmembrane domain 108 130 N/A INTRINSIC
Pfam:ARL6IP6 138 214 3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076313
SMART Domains Protein: ENSMUSP00000075655
Gene: ENSMUSG00000061136

DomainStartEndE-ValueType
low complexity region 77 124 N/A INTRINSIC
WW 141 173 7.54e-13 SMART
WW 182 214 1.57e-10 SMART
low complexity region 272 294 N/A INTRINSIC
FF 389 443 1.32e-17 SMART
FF 456 515 4.22e1 SMART
FF 523 583 1.11e-10 SMART
FF 603 663 4.31e0 SMART
low complexity region 670 682 N/A INTRINSIC
FF 739 795 7.43e-12 SMART
low complexity region 802 879 N/A INTRINSIC
low complexity region 883 923 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125243
SMART Domains Protein: ENSMUSP00000117406
Gene: ENSMUSG00000061136

DomainStartEndE-ValueType
low complexity region 35 82 N/A INTRINSIC
WW 99 131 7.54e-13 SMART
WW 140 172 1.57e-10 SMART
low complexity region 230 252 N/A INTRINSIC
FF 347 401 1.32e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155517
Predicted Effect probably benign
Transcript: ENSMUST00000209364
Predicted Effect probably benign
Transcript: ENSMUST00000209508
Predicted Effect probably benign
Transcript: ENSMUST00000210789
Predicted Effect probably benign
Transcript: ENSMUST00000211102
Predicted Effect probably benign
Transcript: ENSMUST00000211712
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Arl6ip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Arl6ip6 APN 2 53202924 missense probably damaging 1.00
IGL01391:Arl6ip6 APN 2 53192144 missense probably benign 0.11
IGL02449:Arl6ip6 APN 2 53192526 unclassified probably benign
IGL02553:Arl6ip6 APN 2 53192214 missense possibly damaging 0.88
IGL02887:Arl6ip6 APN 2 53202927 missense probably benign 0.06
R0372:Arl6ip6 UTSW 2 53202921 missense probably damaging 0.99
R1604:Arl6ip6 UTSW 2 53192496 missense probably damaging 1.00
R2366:Arl6ip6 UTSW 2 53192367 missense probably benign 0.05
R7622:Arl6ip6 UTSW 2 53217327 missense probably damaging 1.00
R8283:Arl6ip6 UTSW 2 53192238 missense possibly damaging 0.74
R8858:Arl6ip6 UTSW 2 53203006 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGAGAGTGTTGTCGCGG -3'
(R):5'- AACGATCATGTAGGCGATGG -3'

Sequencing Primer
(F):5'- ACGGCCGTCTCTGATTGG -3'
(R):5'- TTCGCTTGGCCGCAGTG -3'
Posted On 2015-04-02