Incidental Mutation 'R3765:Dpp4'
ID274636
Institutional Source Beutler Lab
Gene Symbol Dpp4
Ensembl Gene ENSMUSG00000035000
Gene Namedipeptidylpeptidase 4
SynonymsDpp-4, THAM, Cd26
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location62330073-62412231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62386436 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 92 (T92S)
Ref Sequence ENSEMBL: ENSMUSP00000044050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047812]
Predicted Effect probably benign
Transcript: ENSMUST00000047812
AA Change: T92S

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044050
Gene: ENSMUSG00000035000
AA Change: T92S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 102 473 5.7e-110 PFAM
Pfam:Abhydrolase_5 545 752 1e-11 PFAM
Pfam:DLH 546 754 4e-7 PFAM
Pfam:Peptidase_S9 551 760 3.4e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149306
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic membrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show hypoglycemia, hyperinsulinemia, and increased plasma glucagon-like peptide 1 in glucose tolerance tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Dpp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dpp4 APN 2 62379302 missense probably damaging 1.00
IGL02205:Dpp4 APN 2 62352257 missense probably damaging 1.00
IGL02276:Dpp4 APN 2 62356951 splice site probably benign
IGL02335:Dpp4 APN 2 62334644 missense probably benign 0.03
IGL02615:Dpp4 APN 2 62359328 missense probably damaging 1.00
IGL02639:Dpp4 APN 2 62352240 missense probably benign
IGL02972:Dpp4 APN 2 62352225 missense probably damaging 1.00
IGL03366:Dpp4 APN 2 62356957 splice site probably null
caribou UTSW 2 62347901 missense possibly damaging 0.69
PIT4449001:Dpp4 UTSW 2 62356644 missense probably benign 0.00
R0502:Dpp4 UTSW 2 62364988 missense probably damaging 0.99
R0581:Dpp4 UTSW 2 62356676 missense probably benign
R1004:Dpp4 UTSW 2 62332640 missense probably benign 0.08
R1075:Dpp4 UTSW 2 62352286 missense probably benign 0.39
R1476:Dpp4 UTSW 2 62347901 missense possibly damaging 0.69
R1702:Dpp4 UTSW 2 62386429 critical splice donor site probably null
R1707:Dpp4 UTSW 2 62359335 splice site probably benign
R1733:Dpp4 UTSW 2 62372869 critical splice acceptor site probably null
R1899:Dpp4 UTSW 2 62345050 splice site probably benign
R2264:Dpp4 UTSW 2 62378239 missense possibly damaging 0.71
R2496:Dpp4 UTSW 2 62387133 missense possibly damaging 0.90
R4278:Dpp4 UTSW 2 62379323 missense probably damaging 1.00
R4413:Dpp4 UTSW 2 62387140 missense possibly damaging 0.89
R4432:Dpp4 UTSW 2 62345112 missense probably damaging 1.00
R4647:Dpp4 UTSW 2 62334605 missense probably damaging 1.00
R4710:Dpp4 UTSW 2 62360315 missense probably benign 0.04
R4914:Dpp4 UTSW 2 62347892 missense probably benign 0.20
R5173:Dpp4 UTSW 2 62387130 missense probably damaging 1.00
R5283:Dpp4 UTSW 2 62360336 missense probably damaging 1.00
R5698:Dpp4 UTSW 2 62334311 missense probably damaging 1.00
R6621:Dpp4 UTSW 2 62352140 missense probably damaging 1.00
R6681:Dpp4 UTSW 2 62348549 missense probably benign 0.01
R6739:Dpp4 UTSW 2 62387095 missense probably benign
R6962:Dpp4 UTSW 2 62372830 missense probably benign 0.11
R7249:Dpp4 UTSW 2 62385203 missense probably benign 0.14
R7268:Dpp4 UTSW 2 62347842 missense probably damaging 1.00
R7343:Dpp4 UTSW 2 62358901 nonsense probably null
R7357:Dpp4 UTSW 2 62387077 missense probably benign
R7366:Dpp4 UTSW 2 62354599 missense probably damaging 1.00
R7413:Dpp4 UTSW 2 62356989 missense probably damaging 1.00
R7431:Dpp4 UTSW 2 62352238 missense probably benign 0.01
R7642:Dpp4 UTSW 2 62360283 critical splice donor site probably null
R8004:Dpp4 UTSW 2 62358828 missense probably benign 0.00
R8197:Dpp4 UTSW 2 62372827 missense probably benign 0.31
R8341:Dpp4 UTSW 2 62347890 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCCATGGAGTGAAGACAAATCC -3'
(R):5'- TTATGTGCCCTGTGTGAACG -3'

Sequencing Primer
(F):5'- TCCAGAGGAACACTTACATTCAAG -3'
(R):5'- GCAATCTGTCGTACTGATC -3'
Posted On2015-04-02