Incidental Mutation 'R3765:Gstm2'
ID274641
Institutional Source Beutler Lab
Gene Symbol Gstm2
Ensembl Gene ENSMUSG00000040562
Gene Nameglutathione S-transferase, mu 2
SynonymsGstb2, Gstb-2
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107981702-107986453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107984030 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 124 (F124S)
Ref Sequence ENSEMBL: ENSMUSP00000066675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012348] [ENSMUST00000066530]
Predicted Effect probably damaging
Transcript: ENSMUST00000012348
AA Change: F158S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000012348
Gene: ENSMUSG00000040562
AA Change: F158S

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.9e-24 PFAM
Pfam:GST_C_3 41 190 1.2e-10 PFAM
Pfam:GST_C 104 191 5.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066530
AA Change: F124S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066675
Gene: ENSMUSG00000040562
AA Change: F124S

DomainStartEndE-ValueType
Pfam:GST_N 1 48 6.8e-12 PFAM
Pfam:GST_C 70 158 8.4e-20 PFAM
Pfam:GST_C_3 84 156 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150808
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Gstm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Gstm2 APN 3 107985243 splice site probably null
IGL01821:Gstm2 APN 3 107985053 missense possibly damaging 0.51
IGL02662:Gstm2 APN 3 107985062 missense possibly damaging 0.94
IGL02667:Gstm2 APN 3 107986108 missense probably damaging 1.00
IGL03088:Gstm2 APN 3 107986046 missense probably benign 0.00
IGL03341:Gstm2 APN 3 107984205 missense possibly damaging 0.86
R0415:Gstm2 UTSW 3 107984006 missense probably benign 0.37
R1239:Gstm2 UTSW 3 107984028 missense possibly damaging 0.61
R2213:Gstm2 UTSW 3 107986093 missense probably damaging 1.00
R2437:Gstm2 UTSW 3 107984053 splice site probably benign
R4402:Gstm2 UTSW 3 107986054 missense probably benign 0.02
R4805:Gstm2 UTSW 3 107985095 missense possibly damaging 0.92
R5791:Gstm2 UTSW 3 107984128 critical splice donor site probably null
R6918:Gstm2 UTSW 3 107985241 splice site probably null
R7669:Gstm2 UTSW 3 107985676 missense probably benign 0.00
R8224:Gstm2 UTSW 3 107983998 missense probably benign
R8463:Gstm2 UTSW 3 107986356 critical splice donor site probably null
R8918:Gstm2 UTSW 3 107985066 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ACTGAACACAGTTCCATGCTTAAC -3'
(R):5'- CAGAGTACTTAGAGGGTCTCCC -3'

Sequencing Primer
(F):5'- TCGTTTCCATTTGAAGGAGTAGAAAG -3'
(R):5'- CCTGAGAAGATGAAGCTCTACTCTG -3'
Posted On2015-04-02