Incidental Mutation 'R3765:Prmt6'
ID 274642
Institutional Source Beutler Lab
Gene Symbol Prmt6
Ensembl Gene ENSMUSG00000049300
Gene Name protein arginine N-methyltransferase 6
Synonyms Hrmt1l6
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 110153425-110158314 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 110157510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 260 (E260*)
Ref Sequence ENSEMBL: ENSMUSP00000140836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106567] [ENSMUST00000168412] [ENSMUST00000190378]
AlphaFold Q6NZB1
Predicted Effect probably null
Transcript: ENSMUST00000106567
AA Change: E260*
SMART Domains Protein: ENSMUSP00000102177
Gene: ENSMUSG00000049300
AA Change: E260*

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:PRMT5 42 347 5.3e-9 PFAM
Pfam:Met_10 50 206 6.7e-8 PFAM
Pfam:Methyltransf_9 57 218 2.6e-8 PFAM
Pfam:PrmA 70 187 1.6e-10 PFAM
Pfam:MTS 75 189 8.8e-7 PFAM
Pfam:Methyltransf_18 85 191 1.8e-8 PFAM
Pfam:Methyltransf_11 90 188 6.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168412
AA Change: E260*
SMART Domains Protein: ENSMUSP00000129801
Gene: ENSMUSG00000049300
AA Change: E260*

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:PRMT5 42 347 1.3e-10 PFAM
Pfam:Met_10 51 184 1.2e-7 PFAM
Pfam:Methyltransf_9 57 218 2.6e-8 PFAM
Pfam:PrmA 70 187 1.4e-10 PFAM
Pfam:MTS 75 194 5.8e-8 PFAM
Pfam:Methyltransf_18 85 192 4.2e-13 PFAM
Pfam:Methyltransf_26 86 191 6e-10 PFAM
Pfam:Methyltransf_11 90 188 5.9e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190378
AA Change: E260*
SMART Domains Protein: ENSMUSP00000140836
Gene: ENSMUSG00000049300
AA Change: E260*

DomainStartEndE-ValueType
low complexity region 15 35 N/A INTRINSIC
Pfam:PRMT5 42 347 1.3e-10 PFAM
Pfam:Met_10 51 184 1.2e-7 PFAM
Pfam:Methyltransf_9 57 218 2.6e-8 PFAM
Pfam:PrmA 70 187 1.4e-10 PFAM
Pfam:MTS 75 194 5.8e-8 PFAM
Pfam:Methyltransf_18 85 192 4.2e-13 PFAM
Pfam:Methyltransf_26 86 191 6e-10 PFAM
Pfam:Methyltransf_11 90 188 5.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197569
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the arginine N-methyltransferase family, which catalyze the sequential transfer of methyl group from S-adenosyl-L-methionine to the side chain nitrogens of arginine residues within proteins, to form methylated arginine derivatives and S-adenosyl-L-homocysteine. This protein can catalyze both, the formation of omega-N monomethylarginine and asymmetrical dimethylarginine, with a strong preference for the latter. It specifically mediates the asymmetric dimethylation of Arg2 of histone H3, and the methylated form represents a specific tag for epigenetic transcriptional repression. This protein also forms a complex with, and methylates DNA polymerase beta, resulting in stimulation of polymerase activity by enhancing DNA binding and processivity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mouse embryonic fibroblast proliferation and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Ccdc185 T A 1: 182,575,117 (GRCm39) H524L possibly damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Frk A G 10: 34,360,001 (GRCm39) M1V probably null Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prg4 G A 1: 150,327,122 (GRCm39) S898L probably damaging Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Sbf2 A G 7: 109,974,788 (GRCm39) V783A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Setd2 T C 9: 110,423,314 (GRCm39) L345P probably damaging Het
Slc18b1 A G 10: 23,674,647 (GRCm39) D34G probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Slx4 A G 16: 3,798,850 (GRCm39) V1357A probably damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Tns3 G A 11: 8,401,133 (GRCm39) A1055V probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfhx3 A G 8: 109,519,394 (GRCm39) N172S probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Prmt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0029:Prmt6 UTSW 3 110,157,214 (GRCm39) missense probably benign 0.16
R0928:Prmt6 UTSW 3 110,157,998 (GRCm39) missense probably damaging 1.00
R1672:Prmt6 UTSW 3 110,157,887 (GRCm39) missense possibly damaging 0.79
R1748:Prmt6 UTSW 3 110,157,683 (GRCm39) missense probably benign
R3835:Prmt6 UTSW 3 110,158,121 (GRCm39) missense possibly damaging 0.75
R4027:Prmt6 UTSW 3 110,157,257 (GRCm39) missense probably damaging 0.99
R6236:Prmt6 UTSW 3 110,157,214 (GRCm39) missense probably benign 0.16
R7164:Prmt6 UTSW 3 110,157,680 (GRCm39) missense probably benign
R7658:Prmt6 UTSW 3 110,157,701 (GRCm39) missense possibly damaging 0.51
R7821:Prmt6 UTSW 3 110,158,303 (GRCm39) start gained probably benign
R8178:Prmt6 UTSW 3 110,158,140 (GRCm39) missense probably damaging 1.00
R8546:Prmt6 UTSW 3 110,158,034 (GRCm39) missense possibly damaging 0.67
R8927:Prmt6 UTSW 3 110,158,248 (GRCm39) missense probably benign
R8928:Prmt6 UTSW 3 110,158,248 (GRCm39) missense probably benign
R9015:Prmt6 UTSW 3 110,157,214 (GRCm39) missense probably benign 0.16
R9755:Prmt6 UTSW 3 110,157,359 (GRCm39) missense probably damaging 1.00
Z1176:Prmt6 UTSW 3 110,157,446 (GRCm39) missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACCGGCTCGTTCAAGTAGAG -3'
(R):5'- ATTAGCGACCAGATGCTCG -3'

Sequencing Primer
(F):5'- CTCGTTCAAGTAGAGGAGCGC -3'
(R):5'- AGATGCTCGAGTGGCGTC -3'
Posted On 2015-04-02