Incidental Mutation 'R3765:Tada2b'
ID274643
Institutional Source Beutler Lab
Gene Symbol Tada2b
Ensembl Gene ENSMUSG00000029196
Gene Nametranscriptional adaptor 2B
SynonymsLOC231151
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36473670-36484285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36476417 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 197 (D197E)
Ref Sequence ENSEMBL: ENSMUSP00000114124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031097] [ENSMUST00000031099] [ENSMUST00000119916]
Predicted Effect probably benign
Transcript: ENSMUST00000031097
AA Change: D272E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031097
Gene: ENSMUSG00000029196
AA Change: D272E

DomainStartEndE-ValueType
ZnF_ZZ 3 46 2.64e-5 SMART
SANT 66 116 1.75e-9 SMART
low complexity region 138 154 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 306 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031099
SMART Domains Protein: ENSMUSP00000031099
Gene: ENSMUSG00000029198

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:GrpE 32 215 5.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119916
AA Change: D197E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114124
Gene: ENSMUSG00000029196
AA Change: D197E

DomainStartEndE-ValueType
Blast:SANT 16 41 2e-10 BLAST
low complexity region 63 79 N/A INTRINSIC
low complexity region 158 185 N/A INTRINSIC
low complexity region 231 250 N/A INTRINSIC
Meta Mutation Damage Score 0.1195 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TADA2B functions as a transcriptional adaptor protein that potentiates transcription through coordination of histone acetyltransferase (HAT) activity and by linking activation factors to basal transcriptional machinery (Barlev et al., 2003 [PubMed 12972612]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Tada2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Tada2b APN 5 36476073 missense probably damaging 0.99
IGL01453:Tada2b APN 5 36476342 missense probably damaging 1.00
R1654:Tada2b UTSW 5 36483795 missense probably damaging 1.00
R2019:Tada2b UTSW 5 36483906 missense probably damaging 1.00
R2337:Tada2b UTSW 5 36476914 missense probably benign 0.17
R3766:Tada2b UTSW 5 36476417 missense probably benign
R5099:Tada2b UTSW 5 36476400 missense probably benign 0.12
R6154:Tada2b UTSW 5 36476664 missense probably damaging 0.98
R6285:Tada2b UTSW 5 36476842 missense probably damaging 1.00
R6483:Tada2b UTSW 5 36476685 missense possibly damaging 0.74
R7265:Tada2b UTSW 5 36476608 missense probably damaging 1.00
R7318:Tada2b UTSW 5 36483987 missense probably benign
R7346:Tada2b UTSW 5 36476836 missense possibly damaging 0.70
R7523:Tada2b UTSW 5 36476767 missense probably benign 0.00
R7587:Tada2b UTSW 5 36476767 missense probably benign 0.00
R8856:Tada2b UTSW 5 36483822 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCAAACTCGCTGTCTTTGC -3'
(R):5'- ATGTAGACATGTATGTGCGGAAGC -3'

Sequencing Primer
(F):5'- AAACTCGCTGTCTTTGCCATCC -3'
(R):5'- CTGAAGGAGAGGCAGCGC -3'
Posted On2015-04-02