Mutagenetix > Incidental Mutation

Incidental Mutation 'R3765:Tnpo3'

274646

Institutional Source

Beutler Lab

Gene Symbol

Tnpo3

Ensembl Gene

ENSMUSG00000012535

Gene Name

transportin 3

Synonyms

D6Ertd313e, 5730544L10Rik, C430013M08Rik

MMRRC Submission

040742-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

29540827-29609887 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29579689 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 235 (D235G)

Ref Sequence

ENSEMBL: ENSMUSP00000110906 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000170350]

AlphaFold

Q6P2B1

Predicted Effect

probably benign
Transcript: ENSMUST00000012679
AA Change: D235G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535
AA Change: D235G

Domain	Start	End	E-Value	Type
Blast:IBN_N	30	96	6e-35	BLAST
Pfam:Xpo1	101	249	3.5e-30	PFAM
low complexity region	318	328	N/A	INTRINSIC
low complexity region	823	838	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115251
AA Change: D235G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535
AA Change: D235G

Domain	Start	End	E-Value	Type
Blast:IBN_N	30	96	6e-35	BLAST
Pfam:Xpo1	101	249	3e-30	PFAM
low complexity region	318	328	N/A	INTRINSIC
low complexity region	829	844	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164325

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167056

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169302

Predicted Effect

probably benign
Transcript: ENSMUST00000170350

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170634

Meta Mutation Damage Score

0.1060

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap13	T	C	7: 75,608,837	V403A	probably benign	Het
Arid2	T	C	15: 96,370,714	S903P	probably benign	Het
Arl6ip6	T	A	2: 53,192,231	W37R	probably damaging	Het
Bag3	C	T	7: 128,540,271	T162I	probably benign	Het
C4b	G	A	17: 34,729,840	P1545S	probably damaging	Het
Ccdc185	T	A	1: 182,747,552	H524L	possibly damaging	Het
Cfap43	T	C	19: 47,835,575	N119S	probably benign	Het
Churc1	C	A	12: 76,773,283	S22*	probably null	Het
Crbn	T	C	6: 106,795,026	K106E	possibly damaging	Het
Dag1	C	T	9: 108,208,199	G581E	probably damaging	Het
Dpp4	T	A	2: 62,386,436	T92S	probably benign	Het
Fam135a	T	C	1: 24,055,877	T137A	possibly damaging	Het
Fermt1	T	C	2: 132,906,702	D667G	possibly damaging	Het
Foxl2	T	A	9: 98,955,986	I109N	probably damaging	Het
Frk	A	G	10: 34,484,005	M1V	probably null	Het
Fuk	A	G	8: 110,887,104	I775T	probably benign	Het
Gstm2	A	G	3: 107,984,030	F124S	probably damaging	Het
Hmcn1	T	C	1: 150,745,025	S1145G	possibly damaging	Het
Ints10	A	G	8: 68,825,119	T682A	possibly damaging	Het
Jmy	T	C	13: 93,464,711	M396V	possibly damaging	Het
Ldb3	A	T	14: 34,578,682		probably null	Het
Mre11a	A	G	9: 14,809,847	N354S	probably benign	Het
Nbea	A	G	3: 56,005,549	V939A	probably damaging	Het
Nphs1	T	C	7: 30,471,210	S928P	probably damaging	Het
Olfr1463	G	A	19: 13,234,431	M60I	probably damaging	Het
Olfr19	A	G	16: 16,673,315	V222A	probably benign	Het
Olfr311	T	C	11: 58,841,294	F60S	probably damaging	Het
Olfr954	T	A	9: 39,461,624	Y61*	probably null	Het
Pla2g12b	G	A	10: 59,421,501	V169M	probably damaging	Het
Polr1c	C	T	17: 46,247,924	V14M	probably damaging	Het
Prg4	G	A	1: 150,451,371	S898L	probably damaging	Het
Prmt6	C	A	3: 110,250,194	E260*	probably null	Het
Ptx4	A	G	17: 25,122,868	T106A	probably benign	Het
Rab3il1	A	G	19: 10,028,309	T87A	probably damaging	Het
Sbf2	A	G	7: 110,375,581	V783A	probably damaging	Het
Scn2a	A	C	2: 65,682,710	D209A	possibly damaging	Het
Setd2	T	C	9: 110,594,246	L345P	probably damaging	Het
Slc18b1	A	G	10: 23,798,749	D34G	probably damaging	Het
Slc9c1	A	T	16: 45,590,881	M934L	possibly damaging	Het
Slx4	A	G	16: 3,980,986	V1357A	probably damaging	Het
Spidr	T	C	16: 15,968,640	E413G	probably benign	Het
Taar1	A	G	10: 23,921,307	Y301C	probably damaging	Het
Tada2b	A	T	5: 36,476,417	D197E	probably benign	Het
Taf1c	G	T	8: 119,600,485	Y418*	probably null	Het
Tanc2	A	G	11: 105,914,970	D394G	probably damaging	Het
Tns3	G	A	11: 8,451,133	A1055V	probably benign	Het
Wdfy3	A	G	5: 101,861,400	Y2767H	probably damaging	Het
Zfhx3	A	G	8: 108,792,762	N172S	probably damaging	Het
Zfp839	T	C	12: 110,855,163	V137A	probably benign	Het

Other mutations in Tnpo3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Tnpo3	APN	6	29578461	critical splice donor site	probably null
IGL00662:Tnpo3	APN	6	29565846	nonsense	probably null
IGL00753:Tnpo3	APN	6	29565787	missense	probably benign	0.32
IGL00906:Tnpo3	APN	6	29589048	missense	probably damaging	0.99
IGL01311:Tnpo3	APN	6	29586078	missense	possibly damaging	0.53
IGL01934:Tnpo3	APN	6	29575020	missense	probably benign	0.14
IGL01959:Tnpo3	APN	6	29589020	splice site	probably benign
IGL01987:Tnpo3	APN	6	29560201	missense	probably benign	0.02
IGL02137:Tnpo3	APN	6	29609451	missense	probably damaging	1.00
IGL02645:Tnpo3	APN	6	29562900	nonsense	probably null
IGL03409:Tnpo3	APN	6	29555182	missense	probably damaging	1.00
PIT4520001:Tnpo3	UTSW	6	29555222	missense	possibly damaging	0.60
R0012:Tnpo3	UTSW	6	29589177	missense	probably damaging	0.96
R0012:Tnpo3	UTSW	6	29589177	missense	probably damaging	0.96
R0119:Tnpo3	UTSW	6	29568922	missense	possibly damaging	0.91
R0143:Tnpo3	UTSW	6	29565652	splice site	probably benign
R0384:Tnpo3	UTSW	6	29582164	critical splice donor site	probably null
R0597:Tnpo3	UTSW	6	29578565	nonsense	probably null
R0710:Tnpo3	UTSW	6	29586075	missense	possibly damaging	0.84
R0883:Tnpo3	UTSW	6	29554993	splice site	probably benign
R1494:Tnpo3	UTSW	6	29557044	missense	probably damaging	1.00
R1529:Tnpo3	UTSW	6	29560221	missense	possibly damaging	0.70
R1663:Tnpo3	UTSW	6	29565759	missense	probably benign	0.04
R1816:Tnpo3	UTSW	6	29557017	missense	probably benign	0.31
R2077:Tnpo3	UTSW	6	29586144	missense	possibly damaging	0.94
R2113:Tnpo3	UTSW	6	29551872	missense	probably benign	0.07
R2146:Tnpo3	UTSW	6	29589036	missense	probably benign	0.18
R2377:Tnpo3	UTSW	6	29579619	missense	probably benign	0.19
R3766:Tnpo3	UTSW	6	29579689	missense	probably benign	0.00
R4125:Tnpo3	UTSW	6	29560092	missense	probably damaging	1.00
R4525:Tnpo3	UTSW	6	29561398	missense	probably benign	0.02
R4786:Tnpo3	UTSW	6	29578542	missense	probably benign	0.24
R4830:Tnpo3	UTSW	6	29568938	missense	probably benign	0.00
R4948:Tnpo3	UTSW	6	29582260	missense	probably benign	0.01
R5215:Tnpo3	UTSW	6	29582153	splice site	probably benign
R5325:Tnpo3	UTSW	6	29602013	intron	probably benign
R5512:Tnpo3	UTSW	6	29575046	missense	probably damaging	1.00
R5619:Tnpo3	UTSW	6	29565198	nonsense	probably null
R5689:Tnpo3	UTSW	6	29571064	missense	possibly damaging	0.67
R5855:Tnpo3	UTSW	6	29589033	missense	probably damaging	1.00
R6101:Tnpo3	UTSW	6	29588043	nonsense	probably null
R6105:Tnpo3	UTSW	6	29588043	nonsense	probably null
R6137:Tnpo3	UTSW	6	29555268	missense	probably benign	0.00
R6481:Tnpo3	UTSW	6	29571101	missense	possibly damaging	0.91
R6534:Tnpo3	UTSW	6	29572703	splice site	probably null
R6569:Tnpo3	UTSW	6	29571066	missense	possibly damaging	0.62
R6976:Tnpo3	UTSW	6	29572595	nonsense	probably null
R7006:Tnpo3	UTSW	6	29589163	missense	probably damaging	1.00
R7312:Tnpo3	UTSW	6	29562876	missense	possibly damaging	0.47
R7365:Tnpo3	UTSW	6	29556996	missense	probably damaging	1.00
R7686:Tnpo3	UTSW	6	29562900	nonsense	probably null
R7898:Tnpo3	UTSW	6	29565224	missense	probably benign	0.01
R7901:Tnpo3	UTSW	6	29568991	missense	possibly damaging	0.83
R8003:Tnpo3	UTSW	6	29551901	missense	probably benign	0.09
R8144:Tnpo3	UTSW	6	29558762	missense	probably benign
R8147:Tnpo3	UTSW	6	29589214	missense	probably benign	0.01
R8183:Tnpo3	UTSW	6	29558759	missense	probably damaging	0.97
R8297:Tnpo3	UTSW	6	29582303	missense	possibly damaging	0.91
R8329:Tnpo3	UTSW	6	29558833	nonsense	probably null
R8424:Tnpo3	UTSW	6	29555206	missense	probably benign	0.06
R8798:Tnpo3	UTSW	6	29572621	missense	probably benign
R8841:Tnpo3	UTSW	6	29589183	missense	probably damaging	1.00
R9345:Tnpo3	UTSW	6	29558852	missense	probably benign
R9652:Tnpo3	UTSW	6	29560174	nonsense	probably null
R9699:Tnpo3	UTSW	6	29565769	missense	probably benign	0.11
Z1088:Tnpo3	UTSW	6	29565843	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGCTGTAGGTAACCCAGAG -3'
(R):5'- GAGGTCTGACATTATGGGGC -3'

Sequencing Primer
(F):5'- TGTAGGTAACCCAGAGCTCCAG -3'
(R):5'- ATTTCTGTAATCCTAGCACGGGGAAG -3'

Posted On

2015-04-02