Incidental Mutation 'R3765:Tnpo3'
ID 274646
Institutional Source Beutler Lab
Gene Symbol Tnpo3
Ensembl Gene ENSMUSG00000012535
Gene Name transportin 3
Synonyms D6Ertd313e, 5730544L10Rik, C430013M08Rik
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 29540827-29609887 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29579689 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 235 (D235G)
Ref Sequence ENSEMBL: ENSMUSP00000110906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012679] [ENSMUST00000115251] [ENSMUST00000170350]
AlphaFold Q6P2B1
Predicted Effect probably benign
Transcript: ENSMUST00000012679
AA Change: D235G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000012679
Gene: ENSMUSG00000012535
AA Change: D235G

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3.5e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 823 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115251
AA Change: D235G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110906
Gene: ENSMUSG00000012535
AA Change: D235G

DomainStartEndE-ValueType
Blast:IBN_N 30 96 6e-35 BLAST
Pfam:Xpo1 101 249 3e-30 PFAM
low complexity region 318 328 N/A INTRINSIC
low complexity region 829 844 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169302
Predicted Effect probably benign
Transcript: ENSMUST00000170350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170634
Meta Mutation Damage Score 0.1060 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear import receptor for serine/arginine-rich (SR) proteins such as the splicing factors SFRS1 and SFRS2. The encoded protein has also been shown to be involved in HIV-1 infection, apparently through interaction with the HIV-1 capsid protein. Two transcript variants encoding different isoforms as well as a noncoding transcript have been found for this gene.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Tnpo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tnpo3 APN 6 29578461 critical splice donor site probably null
IGL00662:Tnpo3 APN 6 29565846 nonsense probably null
IGL00753:Tnpo3 APN 6 29565787 missense probably benign 0.32
IGL00906:Tnpo3 APN 6 29589048 missense probably damaging 0.99
IGL01311:Tnpo3 APN 6 29586078 missense possibly damaging 0.53
IGL01934:Tnpo3 APN 6 29575020 missense probably benign 0.14
IGL01959:Tnpo3 APN 6 29589020 splice site probably benign
IGL01987:Tnpo3 APN 6 29560201 missense probably benign 0.02
IGL02137:Tnpo3 APN 6 29609451 missense probably damaging 1.00
IGL02645:Tnpo3 APN 6 29562900 nonsense probably null
IGL03409:Tnpo3 APN 6 29555182 missense probably damaging 1.00
PIT4520001:Tnpo3 UTSW 6 29555222 missense possibly damaging 0.60
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0012:Tnpo3 UTSW 6 29589177 missense probably damaging 0.96
R0119:Tnpo3 UTSW 6 29568922 missense possibly damaging 0.91
R0143:Tnpo3 UTSW 6 29565652 splice site probably benign
R0384:Tnpo3 UTSW 6 29582164 critical splice donor site probably null
R0597:Tnpo3 UTSW 6 29578565 nonsense probably null
R0710:Tnpo3 UTSW 6 29586075 missense possibly damaging 0.84
R0883:Tnpo3 UTSW 6 29554993 splice site probably benign
R1494:Tnpo3 UTSW 6 29557044 missense probably damaging 1.00
R1529:Tnpo3 UTSW 6 29560221 missense possibly damaging 0.70
R1663:Tnpo3 UTSW 6 29565759 missense probably benign 0.04
R1816:Tnpo3 UTSW 6 29557017 missense probably benign 0.31
R2077:Tnpo3 UTSW 6 29586144 missense possibly damaging 0.94
R2113:Tnpo3 UTSW 6 29551872 missense probably benign 0.07
R2146:Tnpo3 UTSW 6 29589036 missense probably benign 0.18
R2377:Tnpo3 UTSW 6 29579619 missense probably benign 0.19
R3766:Tnpo3 UTSW 6 29579689 missense probably benign 0.00
R4125:Tnpo3 UTSW 6 29560092 missense probably damaging 1.00
R4525:Tnpo3 UTSW 6 29561398 missense probably benign 0.02
R4786:Tnpo3 UTSW 6 29578542 missense probably benign 0.24
R4830:Tnpo3 UTSW 6 29568938 missense probably benign 0.00
R4948:Tnpo3 UTSW 6 29582260 missense probably benign 0.01
R5215:Tnpo3 UTSW 6 29582153 splice site probably benign
R5325:Tnpo3 UTSW 6 29602013 intron probably benign
R5512:Tnpo3 UTSW 6 29575046 missense probably damaging 1.00
R5619:Tnpo3 UTSW 6 29565198 nonsense probably null
R5689:Tnpo3 UTSW 6 29571064 missense possibly damaging 0.67
R5855:Tnpo3 UTSW 6 29589033 missense probably damaging 1.00
R6101:Tnpo3 UTSW 6 29588043 nonsense probably null
R6105:Tnpo3 UTSW 6 29588043 nonsense probably null
R6137:Tnpo3 UTSW 6 29555268 missense probably benign 0.00
R6481:Tnpo3 UTSW 6 29571101 missense possibly damaging 0.91
R6534:Tnpo3 UTSW 6 29572703 splice site probably null
R6569:Tnpo3 UTSW 6 29571066 missense possibly damaging 0.62
R6976:Tnpo3 UTSW 6 29572595 nonsense probably null
R7006:Tnpo3 UTSW 6 29589163 missense probably damaging 1.00
R7312:Tnpo3 UTSW 6 29562876 missense possibly damaging 0.47
R7365:Tnpo3 UTSW 6 29556996 missense probably damaging 1.00
R7686:Tnpo3 UTSW 6 29562900 nonsense probably null
R7898:Tnpo3 UTSW 6 29565224 missense probably benign 0.01
R7901:Tnpo3 UTSW 6 29568991 missense possibly damaging 0.83
R8003:Tnpo3 UTSW 6 29551901 missense probably benign 0.09
R8144:Tnpo3 UTSW 6 29558762 missense probably benign
R8147:Tnpo3 UTSW 6 29589214 missense probably benign 0.01
R8183:Tnpo3 UTSW 6 29558759 missense probably damaging 0.97
R8297:Tnpo3 UTSW 6 29582303 missense possibly damaging 0.91
R8329:Tnpo3 UTSW 6 29558833 nonsense probably null
R8424:Tnpo3 UTSW 6 29555206 missense probably benign 0.06
R8798:Tnpo3 UTSW 6 29572621 missense probably benign
R8841:Tnpo3 UTSW 6 29589183 missense probably damaging 1.00
R9345:Tnpo3 UTSW 6 29558852 missense probably benign
R9652:Tnpo3 UTSW 6 29560174 nonsense probably null
R9699:Tnpo3 UTSW 6 29565769 missense probably benign 0.11
Z1088:Tnpo3 UTSW 6 29565843 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTGTAGGTAACCCAGAG -3'
(R):5'- GAGGTCTGACATTATGGGGC -3'

Sequencing Primer
(F):5'- TGTAGGTAACCCAGAGCTCCAG -3'
(R):5'- ATTTCTGTAATCCTAGCACGGGGAAG -3'
Posted On 2015-04-02