Incidental Mutation 'R3765:Crbn'
ID274647
Institutional Source Beutler Lab
Gene Symbol Crbn
Ensembl Gene ENSMUSG00000005362
Gene Namecereblon
Synonyms
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.667) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location106780201-106800077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106795026 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 106 (K106E)
Ref Sequence ENSEMBL: ENSMUSP00000144723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013882] [ENSMUST00000113239] [ENSMUST00000151484]
Predicted Effect probably benign
Transcript: ENSMUST00000013882
AA Change: K118E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000013882
Gene: ENSMUSG00000005362
AA Change: K118E

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
LON 82 319 2.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049675
AA Change: K119E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061604
Gene: ENSMUSG00000005362
AA Change: K119E

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
LON 83 320 2.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113239
AA Change: K119E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108865
Gene: ENSMUSG00000005362
AA Change: K119E

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
LON 83 320 2.33e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147087
Predicted Effect possibly damaging
Transcript: ENSMUST00000151484
AA Change: K106E

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144723
Gene: ENSMUSG00000005362
AA Change: K106E

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
LON 70 253 3.1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204230
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with a Lon protease domain, a "regulators of G protein-signaling" (RGS)-like domain and a leucine zipper. It has been proposed to regulate the assembly and surface expression of large-conductance calcium-activated potassium channels in brain and to bind thalidomide. In humans mutation in this gene causes autosomal recessive nonsyndromic mental retardation. In mouse deficiency of this gene serves as a model to study the molecular mechanisms governing learning and memory as they relate to intellectual disability. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired contextual conditioning behavior. Mice homozygous for another knock-out allele exhibit resistance to diet-induced obesity, liver steatosis, glucose intolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Crbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Crbn APN 6 106795043 missense possibly damaging 0.78
PIT4810001:Crbn UTSW 6 106784479 nonsense probably null
R0457:Crbn UTSW 6 106781057 missense probably benign 0.06
R1468:Crbn UTSW 6 106790843 missense probably benign 0.07
R1468:Crbn UTSW 6 106790843 missense probably benign 0.07
R1672:Crbn UTSW 6 106795925 missense probably damaging 1.00
R1710:Crbn UTSW 6 106790945 missense possibly damaging 0.90
R2255:Crbn UTSW 6 106795198 critical splice acceptor site probably null
R2427:Crbn UTSW 6 106783472 missense probably damaging 1.00
R3160:Crbn UTSW 6 106790866 missense probably benign 0.00
R3162:Crbn UTSW 6 106790866 missense probably benign 0.00
R3766:Crbn UTSW 6 106795026 missense possibly damaging 0.64
R4674:Crbn UTSW 6 106790971 missense possibly damaging 0.95
R4703:Crbn UTSW 6 106782922 missense possibly damaging 0.66
R5089:Crbn UTSW 6 106781718 missense possibly damaging 0.76
R5436:Crbn UTSW 6 106795900 missense probably damaging 1.00
R8690:Crbn UTSW 6 106800049 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGAACAGGGAGGTTTTCC -3'
(R):5'- ACCTGGGAGCTGATATGGAG -3'

Sequencing Primer
(F):5'- GTGGAAGTTTTTCAAGAGCCAAACAC -3'
(R):5'- GGAGTTCCACGGGAGAACTTTG -3'
Posted On2015-04-02