Incidental Mutation 'R3765:Nphs1'
ID274648
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Namenephrosis 1, nephrin
Synonymsnephrin
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30458315-30487223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30471210 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 928 (S928P)
Ref Sequence ENSEMBL: ENSMUSP00000116500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: S942P

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: S942P

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123880
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: S928P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: S928P

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTACTCAGTTCTCACTCCGG -3'
(R):5'- AACCAGGATCTTGGCAGGTG -3'

Sequencing Primer
(F):5'- CGGCCCACTTATCCAGC -3'
(R):5'- ATCTTGGCAGGTGACCCAAGTAC -3'
Posted On2015-04-02