Incidental Mutation 'R3765:Sbf2'
ID 274650
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene Name SET binding factor 2
Synonyms B430219L04Rik, 4833411B01Rik, SBF2, Mtmr13, mMTMH1
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 109907220-110214129 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109974788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 783 (V783A)
Ref Sequence ENSEMBL: ENSMUSP00000132072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]
AlphaFold E9PXF8
Predicted Effect possibly damaging
Transcript: ENSMUST00000033058
AA Change: V783A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: V783A

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164759
AA Change: V783A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: V783A

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165449
Predicted Effect probably damaging
Transcript: ENSMUST00000166020
AA Change: V737A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: V737A

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171378
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Ccdc185 T A 1: 182,575,117 (GRCm39) H524L possibly damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Frk A G 10: 34,360,001 (GRCm39) M1V probably null Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prg4 G A 1: 150,327,122 (GRCm39) S898L probably damaging Het
Prmt6 C A 3: 110,157,510 (GRCm39) E260* probably null Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Setd2 T C 9: 110,423,314 (GRCm39) L345P probably damaging Het
Slc18b1 A G 10: 23,674,647 (GRCm39) D34G probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Slx4 A G 16: 3,798,850 (GRCm39) V1357A probably damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Tns3 G A 11: 8,401,133 (GRCm39) A1055V probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfhx3 A G 8: 109,519,394 (GRCm39) N172S probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 109,975,039 (GRCm39) splice site probably benign
IGL01089:Sbf2 APN 7 109,948,169 (GRCm39) missense probably damaging 1.00
IGL01144:Sbf2 APN 7 109,929,110 (GRCm39) missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110,046,327 (GRCm39) missense probably damaging 1.00
IGL01950:Sbf2 APN 7 109,965,032 (GRCm39) missense probably benign 0.00
IGL02027:Sbf2 APN 7 110,060,348 (GRCm39) missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110,159,502 (GRCm39) missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110,062,163 (GRCm39) missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110,062,139 (GRCm39) missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 109,911,959 (GRCm39) missense probably benign
R0084:Sbf2 UTSW 7 110,041,573 (GRCm39) missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 109,920,013 (GRCm39) splice site probably benign
R0121:Sbf2 UTSW 7 110,088,426 (GRCm39) critical splice donor site probably null
R0464:Sbf2 UTSW 7 110,063,783 (GRCm39) splice site probably benign
R0505:Sbf2 UTSW 7 109,998,550 (GRCm39) missense probably damaging 1.00
R0531:Sbf2 UTSW 7 109,966,530 (GRCm39) splice site probably benign
R0554:Sbf2 UTSW 7 110,027,494 (GRCm39) missense probably damaging 1.00
R0617:Sbf2 UTSW 7 109,929,890 (GRCm39) frame shift probably null
R0619:Sbf2 UTSW 7 109,909,469 (GRCm39) missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 109,940,562 (GRCm39) missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 109,970,859 (GRCm39) missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 109,966,379 (GRCm39) splice site probably benign
R1167:Sbf2 UTSW 7 109,963,756 (GRCm39) missense probably damaging 1.00
R1169:Sbf2 UTSW 7 109,909,391 (GRCm39) missense probably benign 0.04
R1424:Sbf2 UTSW 7 109,914,233 (GRCm39) missense probably damaging 1.00
R1536:Sbf2 UTSW 7 109,977,250 (GRCm39) missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110,027,553 (GRCm39) missense probably damaging 1.00
R1601:Sbf2 UTSW 7 109,939,283 (GRCm39) critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 109,911,965 (GRCm39) missense probably benign
R1771:Sbf2 UTSW 7 110,060,353 (GRCm39) nonsense probably null
R1989:Sbf2 UTSW 7 109,948,130 (GRCm39) missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110,060,419 (GRCm39) missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110,159,502 (GRCm39) missense probably damaging 1.00
R2444:Sbf2 UTSW 7 109,929,905 (GRCm39) missense probably benign 0.31
R3808:Sbf2 UTSW 7 110,088,487 (GRCm39) makesense probably null
R3895:Sbf2 UTSW 7 110,046,298 (GRCm39) missense probably damaging 0.99
R3978:Sbf2 UTSW 7 109,929,092 (GRCm39) missense probably benign 0.00
R4056:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110,027,449 (GRCm39) missense probably damaging 1.00
R4569:Sbf2 UTSW 7 109,948,060 (GRCm39) critical splice donor site probably null
R4670:Sbf2 UTSW 7 109,934,606 (GRCm39) missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110,020,124 (GRCm39) missense probably damaging 1.00
R4792:Sbf2 UTSW 7 109,950,817 (GRCm39) missense probably damaging 0.98
R4811:Sbf2 UTSW 7 109,971,742 (GRCm39) missense probably damaging 1.00
R4822:Sbf2 UTSW 7 109,977,146 (GRCm39) intron probably benign
R5110:Sbf2 UTSW 7 109,963,864 (GRCm39) missense probably benign 0.10
R5143:Sbf2 UTSW 7 110,021,747 (GRCm39) nonsense probably null
R5443:Sbf2 UTSW 7 109,977,135 (GRCm39) intron probably benign
R5457:Sbf2 UTSW 7 109,912,037 (GRCm39) missense probably benign
R5641:Sbf2 UTSW 7 110,038,108 (GRCm39) missense probably damaging 1.00
R5915:Sbf2 UTSW 7 109,977,303 (GRCm39) nonsense probably null
R5948:Sbf2 UTSW 7 110,088,492 (GRCm39) missense probably damaging 1.00
R5977:Sbf2 UTSW 7 109,977,193 (GRCm39) missense probably benign 0.00
R6052:Sbf2 UTSW 7 110,040,741 (GRCm39) missense probably damaging 1.00
R6142:Sbf2 UTSW 7 109,948,182 (GRCm39) missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110,040,759 (GRCm39) missense probably damaging 1.00
R6356:Sbf2 UTSW 7 109,971,830 (GRCm39) missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110,062,070 (GRCm39) missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110,040,182 (GRCm39) missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110,159,505 (GRCm39) missense probably benign 0.04
R6986:Sbf2 UTSW 7 109,929,822 (GRCm39) missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110,046,268 (GRCm39) missense probably benign 0.01
R7358:Sbf2 UTSW 7 109,998,555 (GRCm39) missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 109,913,271 (GRCm39) missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 109,965,028 (GRCm39) missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110,038,055 (GRCm39) missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 109,974,984 (GRCm39) nonsense probably null
R7431:Sbf2 UTSW 7 109,950,957 (GRCm39) missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110,213,923 (GRCm39) nonsense probably null
R7556:Sbf2 UTSW 7 109,913,260 (GRCm39) missense probably benign 0.20
R7604:Sbf2 UTSW 7 109,977,274 (GRCm39) missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 109,929,920 (GRCm39) critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110,040,633 (GRCm39) missense probably benign 0.01
R7812:Sbf2 UTSW 7 110,049,170 (GRCm39) missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 109,971,717 (GRCm39) missense probably damaging 1.00
R8026:Sbf2 UTSW 7 109,934,594 (GRCm39) missense probably damaging 1.00
R8048:Sbf2 UTSW 7 109,914,289 (GRCm39) missense probably benign 0.21
R8305:Sbf2 UTSW 7 109,970,825 (GRCm39) missense possibly damaging 0.79
R8337:Sbf2 UTSW 7 110,040,669 (GRCm39) missense probably benign
R8773:Sbf2 UTSW 7 109,948,202 (GRCm39) missense probably benign
R8786:Sbf2 UTSW 7 110,063,793 (GRCm39) critical splice donor site probably null
R8812:Sbf2 UTSW 7 109,929,069 (GRCm39) missense probably damaging 1.00
R8876:Sbf2 UTSW 7 110,049,146 (GRCm39) missense probably damaging 0.99
R8932:Sbf2 UTSW 7 110,040,155 (GRCm39) critical splice donor site probably null
R8954:Sbf2 UTSW 7 110,038,118 (GRCm39) nonsense probably null
R8991:Sbf2 UTSW 7 109,911,896 (GRCm39) missense probably benign 0.20
R9119:Sbf2 UTSW 7 109,911,292 (GRCm39) missense possibly damaging 0.93
R9310:Sbf2 UTSW 7 109,914,292 (GRCm39) missense possibly damaging 0.58
R9344:Sbf2 UTSW 7 109,940,535 (GRCm39) missense probably benign 0.10
R9346:Sbf2 UTSW 7 109,919,946 (GRCm39) missense probably benign 0.05
R9404:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9406:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9408:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9472:Sbf2 UTSW 7 109,970,798 (GRCm39) missense possibly damaging 0.88
R9554:Sbf2 UTSW 7 110,040,671 (GRCm39) missense probably damaging 1.00
R9562:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9624:Sbf2 UTSW 7 109,963,857 (GRCm39) missense probably damaging 1.00
R9652:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9653:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9709:Sbf2 UTSW 7 110,027,514 (GRCm39) missense probably damaging 0.99
RF005:Sbf2 UTSW 7 109,916,215 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGAGGTGTAGAGGTGCA -3'
(R):5'- TGAGCAAGTCAACTCAGCAG -3'

Sequencing Primer
(F):5'- TGTAGAGGTGTAGAAGTGCATGC -3'
(R):5'- TTCCACTCGACACGAGTA -3'
Posted On 2015-04-02