Incidental Mutation 'R3765:Bag3'
ID274651
Institutional Source Beutler Lab
Gene Symbol Bag3
Ensembl Gene ENSMUSG00000030847
Gene NameBCL2-associated athanogene 3
SynonymsBcl-2-interacting death suppressor, Bis
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128523616-128546981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128540271 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 162 (T162I)
Ref Sequence ENSEMBL: ENSMUSP00000033136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033136]
PDB Structure Solution structure of the Murine BAG domain of Bcl2-associated athanogene 3 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000033136
AA Change: T162I

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033136
Gene: ENSMUSG00000030847
AA Change: T162I

DomainStartEndE-ValueType
WW 23 56 1.49e-11 SMART
internal_repeat_1 90 151 3.37e-5 PROSPERO
low complexity region 158 171 N/A INTRINSIC
low complexity region 176 204 N/A INTRINSIC
internal_repeat_1 206 283 3.37e-5 PROSPERO
low complexity region 372 392 N/A INTRINSIC
low complexity region 396 419 N/A INTRINSIC
BAG 426 503 9.22e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206512
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit postnatal lethality, growth retardation, cardiomyocyte and skeletal myocyte degeneration, and pulmonary edema. Mice homozygous for a null allele also exhibit postnatal lethality and growth retardation but lack the myocyte degeneration phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Bag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Bag3 APN 7 128546341 missense probably benign 0.03
IGL01942:Bag3 APN 7 128546300 missense probably benign 0.00
PIT4377001:Bag3 UTSW 7 128545717 missense probably damaging 1.00
R0577:Bag3 UTSW 7 128523887 missense probably benign 0.00
R1730:Bag3 UTSW 7 128523859 start codon destroyed possibly damaging 0.89
R1991:Bag3 UTSW 7 128545683 missense probably benign
R2065:Bag3 UTSW 7 128545774 missense probably damaging 0.96
R2198:Bag3 UTSW 7 128545769 frame shift probably null
R2201:Bag3 UTSW 7 128545769 frame shift probably null
R3407:Bag3 UTSW 7 128545768 frame shift probably null
R3407:Bag3 UTSW 7 128545769 frame shift probably null
R3408:Bag3 UTSW 7 128545769 frame shift probably null
R4201:Bag3 UTSW 7 128546157 missense probably damaging 1.00
R4430:Bag3 UTSW 7 128523923 missense probably damaging 0.99
R5642:Bag3 UTSW 7 128546106 missense probably damaging 1.00
R6112:Bag3 UTSW 7 128541832 missense probably damaging 0.99
R6298:Bag3 UTSW 7 128540198 missense probably damaging 0.99
R8145:Bag3 UTSW 7 128545888 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCCATGAAGGCTCCGAGAAC -3'
(R):5'- TAAGCCATGTGATCTCTGGCC -3'

Sequencing Primer
(F):5'- AGAACCGGCAGCCCCAC -3'
(R):5'- TCTCTGGCCATCTGAAAAATACAGG -3'
Posted On2015-04-02