Incidental Mutation 'R3765:Zfhx3'
ID 274652
Institutional Source Beutler Lab
Gene Symbol Zfhx3
Ensembl Gene ENSMUSG00000038872
Gene Name zinc finger homeobox 3
Synonyms Sci, A230102L03Rik, WBP9, Atbf1
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.923) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 109005975-109688268 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109519394 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 172 (N172S)
Ref Sequence ENSEMBL: ENSMUSP00000152353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043896] [ENSMUST00000188994] [ENSMUST00000220518]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000043896
AA Change: N172S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044612
Gene: ENSMUSG00000038872
AA Change: N172S

DomainStartEndE-ValueType
ZnF_C2H2 79 103 7.89e0 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
ZnF_C2H2 282 305 1.36e1 SMART
low complexity region 393 411 N/A INTRINSIC
coiled coil region 453 496 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
ZnF_C2H2 641 664 3.47e0 SMART
ZnF_C2H2 672 695 6.78e-3 SMART
ZnF_U1 724 758 5.71e-1 SMART
ZnF_C2H2 727 751 4.87e-4 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 796 804 N/A INTRINSIC
ZnF_C2H2 805 829 6.67e-2 SMART
ZnF_U1 982 1016 2.35e0 SMART
ZnF_C2H2 985 1009 4.57e0 SMART
ZnF_C2H2 1041 1065 3.99e0 SMART
ZnF_U1 1086 1120 1.36e0 SMART
ZnF_C2H2 1089 1113 1.33e-1 SMART
ZnF_C2H2 1233 1256 4.11e-2 SMART
ZnF_C2H2 1262 1285 4.34e-1 SMART
ZnF_C2H2 1370 1395 1.08e-1 SMART
ZnF_C2H2 1411 1433 3.34e-2 SMART
ZnF_C2H2 1439 1462 8.09e-1 SMART
low complexity region 1500 1512 N/A INTRINSIC
ZnF_U1 1552 1586 1.05e0 SMART
ZnF_C2H2 1555 1579 8.22e-2 SMART
ZnF_U1 1603 1637 4.19e0 SMART
ZnF_C2H2 1606 1630 1.16e-1 SMART
low complexity region 1643 1669 N/A INTRINSIC
low complexity region 1734 1776 N/A INTRINSIC
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1842 1878 N/A INTRINSIC
low complexity region 1881 1894 N/A INTRINSIC
low complexity region 1967 1985 N/A INTRINSIC
ZnF_C2H2 1990 2013 1.62e0 SMART
low complexity region 2041 2088 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
HOX 2152 2214 1.13e-16 SMART
HOX 2249 2311 2.41e-20 SMART
ZnF_C2H2 2335 2355 1.72e1 SMART
low complexity region 2383 2414 N/A INTRINSIC
low complexity region 2458 2473 N/A INTRINSIC
low complexity region 2476 2521 N/A INTRINSIC
ZnF_C2H2 2539 2561 1.79e-2 SMART
low complexity region 2606 2619 N/A INTRINSIC
HOX 2650 2712 2.97e-20 SMART
ZnF_C2H2 2720 2743 7.67e-2 SMART
low complexity region 2929 2950 N/A INTRINSIC
HOX 2954 3016 1.07e-17 SMART
ZnF_U1 3029 3063 1.8e-1 SMART
ZnF_C2H2 3032 3056 8.31e0 SMART
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3181 3235 N/A INTRINSIC
low complexity region 3237 3256 N/A INTRINSIC
low complexity region 3268 3282 N/A INTRINSIC
low complexity region 3290 3299 N/A INTRINSIC
coiled coil region 3362 3417 N/A INTRINSIC
low complexity region 3452 3476 N/A INTRINSIC
ZnF_C2H2 3489 3509 1.45e2 SMART
ZnF_U1 3546 3580 1.36e0 SMART
ZnF_C2H2 3549 3573 1.77e1 SMART
low complexity region 3602 3633 N/A INTRINSIC
low complexity region 3642 3674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188994
Predicted Effect probably damaging
Transcript: ENSMUST00000220518
AA Change: N172S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal initial pituitary development but reduced GH and TSH-beta staining within the pituitary by E17.5. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for the same allele exhibit partial postnatal lethality, decreased body size and prolonged conception time. [provided by MGI curators]
Allele List at MGI

 All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Ccdc185 T A 1: 182,575,117 (GRCm39) H524L possibly damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Frk A G 10: 34,360,001 (GRCm39) M1V probably null Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prg4 G A 1: 150,327,122 (GRCm39) S898L probably damaging Het
Prmt6 C A 3: 110,157,510 (GRCm39) E260* probably null Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Sbf2 A G 7: 109,974,788 (GRCm39) V783A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Setd2 T C 9: 110,423,314 (GRCm39) L345P probably damaging Het
Slc18b1 A G 10: 23,674,647 (GRCm39) D34G probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Slx4 A G 16: 3,798,850 (GRCm39) V1357A probably damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Tns3 G A 11: 8,401,133 (GRCm39) A1055V probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Zfhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Zfhx3 APN 8 109,520,226 (GRCm39) missense probably benign 0.00
IGL01946:Zfhx3 APN 8 109,660,561 (GRCm39) missense probably damaging 0.98
IGL01973:Zfhx3 APN 8 109,673,825 (GRCm39) missense probably damaging 1.00
IGL01983:Zfhx3 APN 8 109,673,866 (GRCm39) missense probably damaging 1.00
IGL02151:Zfhx3 APN 8 109,520,515 (GRCm39) missense probably damaging 1.00
IGL02405:Zfhx3 APN 8 109,682,374 (GRCm39) missense unknown
IGL02406:Zfhx3 APN 8 109,682,374 (GRCm39) missense unknown
IGL02408:Zfhx3 APN 8 109,682,004 (GRCm39) splice site probably benign
IGL02549:Zfhx3 APN 8 109,527,141 (GRCm39) missense probably damaging 1.00
IGL02601:Zfhx3 APN 8 109,583,462 (GRCm39) missense probably damaging 1.00
IGL02649:Zfhx3 APN 8 109,520,167 (GRCm39) missense possibly damaging 0.94
IGL03027:Zfhx3 APN 8 109,519,820 (GRCm39) missense probably damaging 0.98
IGL03053:Zfhx3 APN 8 109,673,132 (GRCm39) missense probably damaging 0.99
IGL03168:Zfhx3 APN 8 109,673,132 (GRCm39) missense probably damaging 0.99
IGL03194:Zfhx3 APN 8 109,521,359 (GRCm39) missense probably damaging 0.97
IGL03248:Zfhx3 APN 8 109,673,182 (GRCm39) missense probably damaging 1.00
FR4449:Zfhx3 UTSW 8 109,682,726 (GRCm39) small insertion probably benign
FR4589:Zfhx3 UTSW 8 109,682,733 (GRCm39) small insertion probably benign
FR4737:Zfhx3 UTSW 8 109,682,735 (GRCm39) small insertion probably benign
FR4737:Zfhx3 UTSW 8 109,682,734 (GRCm39) small insertion probably benign
FR4737:Zfhx3 UTSW 8 109,682,720 (GRCm39) small insertion probably benign
G5030:Zfhx3 UTSW 8 109,678,091 (GRCm39) missense possibly damaging 0.86
R0016:Zfhx3 UTSW 8 109,676,810 (GRCm39) missense probably benign 0.02
R0090:Zfhx3 UTSW 8 109,676,689 (GRCm39) missense possibly damaging 0.85
R0330:Zfhx3 UTSW 8 109,675,589 (GRCm39) missense probably damaging 1.00
R0332:Zfhx3 UTSW 8 109,673,255 (GRCm39) missense probably damaging 1.00
R0398:Zfhx3 UTSW 8 109,677,878 (GRCm39) missense probably damaging 0.98
R0539:Zfhx3 UTSW 8 109,527,141 (GRCm39) missense probably damaging 1.00
R0546:Zfhx3 UTSW 8 109,520,819 (GRCm39) missense probably damaging 1.00
R0614:Zfhx3 UTSW 8 109,675,599 (GRCm39) nonsense probably null
R0614:Zfhx3 UTSW 8 109,675,171 (GRCm39) missense probably benign 0.03
R0653:Zfhx3 UTSW 8 109,673,440 (GRCm39) missense possibly damaging 0.95
R0718:Zfhx3 UTSW 8 109,682,282 (GRCm39) missense unknown
R0825:Zfhx3 UTSW 8 109,675,840 (GRCm39) missense probably damaging 0.99
R1143:Zfhx3 UTSW 8 109,521,043 (GRCm39) missense probably damaging 1.00
R1319:Zfhx3 UTSW 8 109,660,465 (GRCm39) missense probably damaging 0.99
R1347:Zfhx3 UTSW 8 109,527,330 (GRCm39) splice site probably benign
R1412:Zfhx3 UTSW 8 109,641,199 (GRCm39) missense possibly damaging 0.88
R1447:Zfhx3 UTSW 8 109,675,076 (GRCm39) missense probably benign 0.03
R1530:Zfhx3 UTSW 8 109,675,121 (GRCm39) missense probably damaging 1.00
R1745:Zfhx3 UTSW 8 109,682,494 (GRCm39) missense unknown
R1764:Zfhx3 UTSW 8 109,678,276 (GRCm39) missense probably benign 0.18
R1781:Zfhx3 UTSW 8 109,520,167 (GRCm39) missense probably benign 0.01
R1917:Zfhx3 UTSW 8 109,682,880 (GRCm39) missense unknown
R1956:Zfhx3 UTSW 8 109,520,774 (GRCm39) missense probably benign 0.02
R2049:Zfhx3 UTSW 8 109,671,809 (GRCm39) missense probably benign 0.01
R2196:Zfhx3 UTSW 8 109,526,885 (GRCm39) missense probably damaging 1.00
R3085:Zfhx3 UTSW 8 109,682,664 (GRCm39) missense unknown
R4162:Zfhx3 UTSW 8 109,683,619 (GRCm39) missense unknown
R4243:Zfhx3 UTSW 8 109,518,952 (GRCm39) missense probably damaging 0.97
R4380:Zfhx3 UTSW 8 109,683,022 (GRCm39) missense unknown
R4433:Zfhx3 UTSW 8 109,682,269 (GRCm39) missense unknown
R4509:Zfhx3 UTSW 8 109,520,411 (GRCm39) missense probably benign 0.01
R4731:Zfhx3 UTSW 8 109,682,716 (GRCm39) missense unknown
R4788:Zfhx3 UTSW 8 109,520,842 (GRCm39) missense probably damaging 1.00
R4812:Zfhx3 UTSW 8 109,674,593 (GRCm39) missense possibly damaging 0.83
R4893:Zfhx3 UTSW 8 109,683,639 (GRCm39) missense unknown
R4907:Zfhx3 UTSW 8 109,519,986 (GRCm39) missense probably damaging 0.99
R4935:Zfhx3 UTSW 8 109,674,482 (GRCm39) missense possibly damaging 0.92
R4943:Zfhx3 UTSW 8 109,674,949 (GRCm39) missense probably damaging 0.98
R5154:Zfhx3 UTSW 8 109,527,207 (GRCm39) missense probably damaging 1.00
R5377:Zfhx3 UTSW 8 109,677,817 (GRCm39) missense possibly damaging 0.95
R5388:Zfhx3 UTSW 8 109,673,446 (GRCm39) missense possibly damaging 0.88
R5434:Zfhx3 UTSW 8 109,519,031 (GRCm39) missense probably damaging 0.99
R5445:Zfhx3 UTSW 8 109,682,842 (GRCm39) missense unknown
R5541:Zfhx3 UTSW 8 109,675,583 (GRCm39) missense probably damaging 0.99
R5571:Zfhx3 UTSW 8 109,682,623 (GRCm39) missense unknown
R5700:Zfhx3 UTSW 8 109,660,499 (GRCm39) missense probably damaging 1.00
R5754:Zfhx3 UTSW 8 109,526,964 (GRCm39) missense probably damaging 0.99
R5867:Zfhx3 UTSW 8 109,520,078 (GRCm39) missense probably damaging 1.00
R5905:Zfhx3 UTSW 8 109,520,135 (GRCm39) missense probably damaging 1.00
R5922:Zfhx3 UTSW 8 109,673,330 (GRCm39) missense probably damaging 1.00
R5972:Zfhx3 UTSW 8 109,677,483 (GRCm39) missense possibly damaging 0.91
R6020:Zfhx3 UTSW 8 109,519,159 (GRCm39) missense probably damaging 1.00
R6028:Zfhx3 UTSW 8 109,520,135 (GRCm39) missense probably damaging 1.00
R6113:Zfhx3 UTSW 8 109,674,053 (GRCm39) missense probably benign 0.04
R6253:Zfhx3 UTSW 8 109,682,020 (GRCm39) missense possibly damaging 0.96
R6356:Zfhx3 UTSW 8 109,673,251 (GRCm39) missense probably damaging 1.00
R6800:Zfhx3 UTSW 8 109,676,149 (GRCm39) missense probably benign 0.20
R6829:Zfhx3 UTSW 8 109,676,915 (GRCm39) missense probably damaging 0.98
R6872:Zfhx3 UTSW 8 109,527,273 (GRCm39) missense probably damaging 1.00
R6873:Zfhx3 UTSW 8 109,527,273 (GRCm39) missense probably damaging 1.00
R6919:Zfhx3 UTSW 8 109,527,160 (GRCm39) missense probably damaging 1.00
R6921:Zfhx3 UTSW 8 109,678,024 (GRCm39) missense possibly damaging 0.53
R6925:Zfhx3 UTSW 8 109,683,453 (GRCm39) missense unknown
R6927:Zfhx3 UTSW 8 109,683,453 (GRCm39) missense unknown
R7152:Zfhx3 UTSW 8 109,674,839 (GRCm39) missense possibly damaging 0.94
R7169:Zfhx3 UTSW 8 109,678,030 (GRCm39) missense possibly damaging 0.86
R7214:Zfhx3 UTSW 8 109,675,493 (GRCm39) missense probably damaging 0.98
R7378:Zfhx3 UTSW 8 109,519,880 (GRCm39) missense probably damaging 0.99
R7391:Zfhx3 UTSW 8 109,674,475 (GRCm39) missense probably damaging 0.96
R7442:Zfhx3 UTSW 8 109,519,468 (GRCm39) missense probably damaging 0.97
R7636:Zfhx3 UTSW 8 109,673,441 (GRCm39) missense probably benign 0.25
R7649:Zfhx3 UTSW 8 109,678,276 (GRCm39) missense probably benign 0.18
R7699:Zfhx3 UTSW 8 109,677,754 (GRCm39) missense probably benign 0.18
R7728:Zfhx3 UTSW 8 109,678,201 (GRCm39) missense probably benign 0.01
R7780:Zfhx3 UTSW 8 109,678,283 (GRCm39) missense possibly damaging 0.53
R7904:Zfhx3 UTSW 8 109,677,695 (GRCm39) missense probably damaging 0.98
R8032:Zfhx3 UTSW 8 109,677,854 (GRCm39) missense possibly damaging 0.51
R8158:Zfhx3 UTSW 8 109,675,353 (GRCm39) missense possibly damaging 0.82
R8163:Zfhx3 UTSW 8 109,675,925 (GRCm39) missense probably damaging 1.00
R8215:Zfhx3 UTSW 8 109,677,349 (GRCm39) missense probably benign
R8217:Zfhx3 UTSW 8 109,677,349 (GRCm39) missense probably benign
R8218:Zfhx3 UTSW 8 109,677,349 (GRCm39) missense probably benign
R8369:Zfhx3 UTSW 8 109,583,448 (GRCm39) missense possibly damaging 0.82
R8424:Zfhx3 UTSW 8 109,583,385 (GRCm39) missense probably damaging 0.98
R8482:Zfhx3 UTSW 8 109,674,511 (GRCm39) missense probably benign 0.02
R8504:Zfhx3 UTSW 8 109,583,549 (GRCm39) missense possibly damaging 0.95
R8871:Zfhx3 UTSW 8 109,676,867 (GRCm39) missense possibly damaging 0.85
R9144:Zfhx3 UTSW 8 109,676,794 (GRCm39) missense possibly damaging 0.53
R9202:Zfhx3 UTSW 8 109,677,920 (GRCm39) missense possibly damaging 0.92
R9213:Zfhx3 UTSW 8 109,676,756 (GRCm39) missense probably benign 0.18
R9218:Zfhx3 UTSW 8 109,520,501 (GRCm39) missense probably benign 0.17
R9370:Zfhx3 UTSW 8 109,521,340 (GRCm39) missense probably damaging 1.00
R9422:Zfhx3 UTSW 8 109,430,850 (GRCm39) start gained probably benign
R9530:Zfhx3 UTSW 8 109,527,010 (GRCm39) missense probably damaging 1.00
RF027:Zfhx3 UTSW 8 109,682,730 (GRCm39) small insertion probably benign
RF028:Zfhx3 UTSW 8 109,682,728 (GRCm39) small insertion probably benign
RF029:Zfhx3 UTSW 8 109,682,724 (GRCm39) small insertion probably benign
RF031:Zfhx3 UTSW 8 109,682,730 (GRCm39) small insertion probably benign
RF032:Zfhx3 UTSW 8 109,682,724 (GRCm39) small insertion probably benign
RF037:Zfhx3 UTSW 8 109,682,730 (GRCm39) nonsense probably null
RF038:Zfhx3 UTSW 8 109,682,733 (GRCm39) small insertion probably benign
RF040:Zfhx3 UTSW 8 109,682,733 (GRCm39) small insertion probably benign
RF042:Zfhx3 UTSW 8 109,682,730 (GRCm39) small insertion probably benign
RF042:Zfhx3 UTSW 8 109,682,720 (GRCm39) small insertion probably benign
RF054:Zfhx3 UTSW 8 109,682,728 (GRCm39) small insertion probably benign
RF060:Zfhx3 UTSW 8 109,682,720 (GRCm39) small insertion probably benign
X0019:Zfhx3 UTSW 8 109,678,285 (GRCm39) missense probably benign 0.00
X0026:Zfhx3 UTSW 8 109,675,777 (GRCm39) missense probably damaging 1.00
Z1088:Zfhx3 UTSW 8 109,677,989 (GRCm39) missense possibly damaging 0.72
Z1176:Zfhx3 UTSW 8 109,527,081 (GRCm39) missense probably damaging 1.00
Z1176:Zfhx3 UTSW 8 109,520,555 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACCTACATGGAGCATCACTG -3'
(R):5'- GCAGAACCATCGCTGTTCAG -3'

Sequencing Primer
(F):5'- CGAGAGGAGAGCGCCAGC -3'
(R):5'- GAACCATCGCTGTTCAGGTAATC -3'
Posted On 2015-04-02