Mutagenetix > Incidental Mutation

Incidental Mutation 'R3765:Taf1c'

274654

Institutional Source

Beutler Lab

Gene Symbol

Taf1c

Ensembl Gene

ENSMUSG00000031832

Gene Name

TATA-box binding protein associated factor, RNA polymerase I, C

Synonyms

mTAFI95

MMRRC Submission

040742-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R3765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119597871-119605222 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 119600485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 418 (Y418*)

Ref Sequence

ENSEMBL: ENSMUSP00000090789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093099] [ENSMUST00000093100] [ENSMUST00000147964]

AlphaFold

Q6PDZ2

Predicted Effect

probably null
Transcript: ENSMUST00000093099
AA Change: Y418*

SMART Domains

Protein: ENSMUSP00000090789
Gene: ENSMUSG00000031832
AA Change: Y418*

Domain	Start	End	E-Value	Type
low complexity region	60	79	N/A	INTRINSIC
SCOP:d1k32a3	253	389	2e-3	SMART
Blast:WD40	301	340	2e-15	BLAST
low complexity region	457	472	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	520	535	N/A	INTRINSIC
low complexity region	724	732	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000093100

SMART Domains

Protein: ENSMUSP00000090790
Gene: ENSMUSG00000031831

Domain	Start	End	E-Value	Type
Pfam:LRR_9	115	298	5.7e-10	PFAM
low complexity region	322	332	N/A	INTRINSIC
low complexity region	482	501	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000117927

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144379

Predicted Effect

probably benign
Transcript: ENSMUST00000147964

SMART Domains

Protein: ENSMUSP00000118480
Gene: ENSMUSG00000031832

Domain	Start	End	E-Value	Type
low complexity region	60	79	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212929

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap13	T	C	7: 75,608,837	V403A	probably benign	Het
Arid2	T	C	15: 96,370,714	S903P	probably benign	Het
Arl6ip6	T	A	2: 53,192,231	W37R	probably damaging	Het
Bag3	C	T	7: 128,540,271	T162I	probably benign	Het
C4b	G	A	17: 34,729,840	P1545S	probably damaging	Het
Ccdc185	T	A	1: 182,747,552	H524L	possibly damaging	Het
Cfap43	T	C	19: 47,835,575	N119S	probably benign	Het
Churc1	C	A	12: 76,773,283	S22*	probably null	Het
Crbn	T	C	6: 106,795,026	K106E	possibly damaging	Het
Dag1	C	T	9: 108,208,199	G581E	probably damaging	Het
Dpp4	T	A	2: 62,386,436	T92S	probably benign	Het
Fam135a	T	C	1: 24,055,877	T137A	possibly damaging	Het
Fermt1	T	C	2: 132,906,702	D667G	possibly damaging	Het
Foxl2	T	A	9: 98,955,986	I109N	probably damaging	Het
Frk	A	G	10: 34,484,005	M1V	probably null	Het
Fuk	A	G	8: 110,887,104	I775T	probably benign	Het
Gstm2	A	G	3: 107,984,030	F124S	probably damaging	Het
Hmcn1	T	C	1: 150,745,025	S1145G	possibly damaging	Het
Ints10	A	G	8: 68,825,119	T682A	possibly damaging	Het
Jmy	T	C	13: 93,464,711	M396V	possibly damaging	Het
Ldb3	A	T	14: 34,578,682		probably null	Het
Mre11a	A	G	9: 14,809,847	N354S	probably benign	Het
Nbea	A	G	3: 56,005,549	V939A	probably damaging	Het
Nphs1	T	C	7: 30,471,210	S928P	probably damaging	Het
Olfr1463	G	A	19: 13,234,431	M60I	probably damaging	Het
Olfr19	A	G	16: 16,673,315	V222A	probably benign	Het
Olfr311	T	C	11: 58,841,294	F60S	probably damaging	Het
Olfr954	T	A	9: 39,461,624	Y61*	probably null	Het
Pla2g12b	G	A	10: 59,421,501	V169M	probably damaging	Het
Polr1c	C	T	17: 46,247,924	V14M	probably damaging	Het
Prg4	G	A	1: 150,451,371	S898L	probably damaging	Het
Prmt6	C	A	3: 110,250,194	E260*	probably null	Het
Ptx4	A	G	17: 25,122,868	T106A	probably benign	Het
Rab3il1	A	G	19: 10,028,309	T87A	probably damaging	Het
Sbf2	A	G	7: 110,375,581	V783A	probably damaging	Het
Scn2a	A	C	2: 65,682,710	D209A	possibly damaging	Het
Setd2	T	C	9: 110,594,246	L345P	probably damaging	Het
Slc18b1	A	G	10: 23,798,749	D34G	probably damaging	Het
Slc9c1	A	T	16: 45,590,881	M934L	possibly damaging	Het
Slx4	A	G	16: 3,980,986	V1357A	probably damaging	Het
Spidr	T	C	16: 15,968,640	E413G	probably benign	Het
Taar1	A	G	10: 23,921,307	Y301C	probably damaging	Het
Tada2b	A	T	5: 36,476,417	D197E	probably benign	Het
Tanc2	A	G	11: 105,914,970	D394G	probably damaging	Het
Tnpo3	T	C	6: 29,579,689	D235G	probably benign	Het
Tns3	G	A	11: 8,451,133	A1055V	probably benign	Het
Wdfy3	A	G	5: 101,861,400	Y2767H	probably damaging	Het
Zfhx3	A	G	8: 108,792,762	N172S	probably damaging	Het
Zfp839	T	C	12: 110,855,163	V137A	probably benign	Het

Other mutations in Taf1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Taf1c	APN	8	119601328	missense	possibly damaging	0.80
IGL01098:Taf1c	APN	8	119602841	missense	probably damaging	0.98
IGL01287:Taf1c	APN	8	119601192	missense	probably benign	0.01
IGL02339:Taf1c	APN	8	119604280	missense	probably damaging	1.00
IGL02642:Taf1c	APN	8	119599057	missense	probably benign
IGL02954:Taf1c	APN	8	119600486	missense	probably damaging	1.00
R0026:Taf1c	UTSW	8	119604236	splice site	probably null
R0031:Taf1c	UTSW	8	119599090	missense	probably benign	0.00
R0087:Taf1c	UTSW	8	119600987	missense	probably damaging	1.00
R0197:Taf1c	UTSW	8	119599983	missense	probably damaging	0.98
R0701:Taf1c	UTSW	8	119599983	missense	probably damaging	0.98
R0883:Taf1c	UTSW	8	119599983	missense	probably damaging	0.98
R2200:Taf1c	UTSW	8	119598678	missense	probably benign
R3726:Taf1c	UTSW	8	119603070	missense	probably damaging	1.00
R3916:Taf1c	UTSW	8	119600505	missense	probably damaging	1.00
R4368:Taf1c	UTSW	8	119599316	missense	possibly damaging	0.60
R4470:Taf1c	UTSW	8	119599622	missense	probably benign
R4501:Taf1c	UTSW	8	119599429	missense	probably damaging	1.00
R4661:Taf1c	UTSW	8	119598850	missense	probably damaging	0.99
R4741:Taf1c	UTSW	8	119603395	unclassified	probably benign
R4938:Taf1c	UTSW	8	119598798	missense	probably benign	0.26
R5481:Taf1c	UTSW	8	119599240	missense	probably damaging	1.00
R6335:Taf1c	UTSW	8	119601779	missense	probably damaging	1.00
R6517:Taf1c	UTSW	8	119604247	missense	possibly damaging	0.59
R7083:Taf1c	UTSW	8	119600668	missense	probably damaging	1.00
R7351:Taf1c	UTSW	8	119599000	missense	probably damaging	0.97
R8056:Taf1c	UTSW	8	119603463	missense	probably benign	0.13
R8170:Taf1c	UTSW	8	119602826	splice site	probably null
R8279:Taf1c	UTSW	8	119599011	missense	probably benign
R8382:Taf1c	UTSW	8	119603050	missense	probably damaging	1.00
R8492:Taf1c	UTSW	8	119598717	missense	probably benign	0.13
R9375:Taf1c	UTSW	8	119598654	missense	probably damaging	0.99
Z1177:Taf1c	UTSW	8	119598827	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCTAGGTTTGCAGATGACCC -3'
(R):5'- AATGGTTGACATTCAGGTATCGG -3'

Sequencing Primer
(F):5'- AGGTTTGCAGATGACCCATTCC -3'
(R):5'- ACATTCAGGTATCGGTTGAGAG -3'

Posted On

2015-04-02