Incidental Mutation 'R3765:Foxl2'
ID 274659
Institutional Source Beutler Lab
Gene Symbol Foxl2
Ensembl Gene ENSMUSG00000050397
Gene Name forkhead box L2
Synonyms Pfrk
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock # R3765 (G1)
Quality Score 170
Status Not validated
Chromosome 9
Chromosomal Location 98955288-98958543 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98955986 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 109 (I109N)
Ref Sequence ENSEMBL: ENSMUSP00000053297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051312]
AlphaFold O88470
Predicted Effect probably damaging
Transcript: ENSMUST00000051312
AA Change: I109N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053297
Gene: ENSMUSG00000050397
AA Change: I109N

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
FH 48 138 2.62e-59 SMART
low complexity region 140 153 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
low complexity region 201 210 N/A INTRINSIC
low complexity region 217 239 N/A INTRINSIC
low complexity region 272 319 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189148
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a forkhead transcription factor. The protein contains a fork-head DNA-binding domain and may play a role in ovarian development and function. Expansion of a polyalanine repeat region and other mutations in this gene are a cause of blepharophimosis syndrome and premature ovarian failure 3. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased postnatal lethality. Of animals surving to mating age, males are fully fertile and females are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Foxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Foxl2 APN 9 98956058 missense probably damaging 1.00
IGL02374:Foxl2 APN 9 98955832 missense probably damaging 1.00
R0763:Foxl2 UTSW 9 98956033 missense probably damaging 1.00
R0840:Foxl2 UTSW 9 98955931 nonsense probably null
R2102:Foxl2 UTSW 9 98956229 missense probably damaging 1.00
R2140:Foxl2 UTSW 9 98956487 missense unknown
R3429:Foxl2 UTSW 9 98955982 missense probably damaging 1.00
R5186:Foxl2 UTSW 9 98956055 missense probably damaging 1.00
R5655:Foxl2 UTSW 9 98955995 missense probably damaging 1.00
R6803:Foxl2 UTSW 9 98955932 missense probably damaging 1.00
R7042:Foxl2 UTSW 9 98955662 start codon destroyed probably null 0.98
Z1191:Foxl2 UTSW 9 98956069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATGATGGCCAGCTACC -3'
(R):5'- AACCCCGATTGCAGGTACTTG -3'

Sequencing Primer
(F):5'- CGCGCAGTCAAAGAGGC -3'
(R):5'- AGGTAGCCATAGCCATCGG -3'
Posted On 2015-04-02