Incidental Mutation 'R3765:Dag1'
ID274660
Institutional Source Beutler Lab
Gene Symbol Dag1
Ensembl Gene ENSMUSG00000039952
Gene Namedystroglycan 1
SynonymsD9Wsu13e, dystrophin associated glycoprotein 1, beta-dystroglycan, DG, alpha-dystroglycan
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R3765 (G1)
Quality Score193
Status Not validated
Chromosome9
Chromosomal Location108204634-108263958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108208199 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 581 (G581E)
Ref Sequence ENSEMBL: ENSMUSP00000142109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080435] [ENSMUST00000166905] [ENSMUST00000171412] [ENSMUST00000191899]
Predicted Effect probably damaging
Transcript: ENSMUST00000080435
AA Change: G581E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079294
Gene: ENSMUSG00000039952
AA Change: G581E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.1e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166905
AA Change: G581E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128531
Gene: ENSMUSG00000039952
AA Change: G581E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.5e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171412
AA Change: G581E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130626
Gene: ENSMUSG00000039952
AA Change: G581E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.1e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191899
AA Change: G581E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142109
Gene: ENSMUSG00000039952
AA Change: G581E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CADG 60 161 1.43e-11 SMART
low complexity region 338 351 N/A INTRINSIC
low complexity region 409 465 N/A INTRINSIC
CADG 496 600 4.74e-26 SMART
Pfam:DAG1 604 893 1.1e-159 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteolytic processing to generate alpha and beta subunits. A complete lack of the encoded protein in mice results in embryonic lethality due to the disorganization of Reichert's membrane. Chimeric mice deficient in the encoded protein overcome embryonic lethality but develop a progressive muscular dystrophy. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mutant embryos show gross abnormalities, particularly defective Reichert's membrane by 6.5 days, indicating a possible role for this gene product in basement membrane organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Dag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Dag1 APN 9 108209288 missense probably damaging 0.99
IGL00780:Dag1 APN 9 108209619 missense probably damaging 1.00
IGL01488:Dag1 APN 9 108208303 missense probably benign 0.33
IGL01843:Dag1 APN 9 108208082 missense possibly damaging 0.92
IGL02140:Dag1 APN 9 108218192 missense probably damaging 1.00
IGL02980:Dag1 UTSW 9 108218038 missense probably benign 0.02
R0037:Dag1 UTSW 9 108207353 missense probably damaging 0.99
R0172:Dag1 UTSW 9 108208832 missense possibly damaging 0.58
R0513:Dag1 UTSW 9 108208485 missense possibly damaging 0.93
R1715:Dag1 UTSW 9 108208715 missense possibly damaging 0.92
R2328:Dag1 UTSW 9 108209252 missense probably damaging 0.99
R2337:Dag1 UTSW 9 108207397 nonsense probably null
R4478:Dag1 UTSW 9 108208730 missense probably damaging 1.00
R5000:Dag1 UTSW 9 108208017 missense probably benign
R5127:Dag1 UTSW 9 108207572 missense possibly damaging 0.86
R5235:Dag1 UTSW 9 108207698 missense probably damaging 0.98
R5265:Dag1 UTSW 9 108207699 missense possibly damaging 0.93
R5315:Dag1 UTSW 9 108209117 missense probably damaging 1.00
R5620:Dag1 UTSW 9 108209015 missense probably damaging 1.00
R5696:Dag1 UTSW 9 108209447 missense probably benign 0.09
R5731:Dag1 UTSW 9 108218111 missense probably benign
R6382:Dag1 UTSW 9 108208137 missense possibly damaging 0.83
R6652:Dag1 UTSW 9 108209090 missense probably damaging 1.00
R6757:Dag1 UTSW 9 108218017 missense probably damaging 0.99
R6870:Dag1 UTSW 9 108209258 missense probably damaging 1.00
R7316:Dag1 UTSW 9 108209502 missense probably benign 0.00
R7343:Dag1 UTSW 9 108209093 missense possibly damaging 0.88
R7543:Dag1 UTSW 9 108218081 missense probably benign
R7733:Dag1 UTSW 9 108208848 missense probably benign 0.33
Z1088:Dag1 UTSW 9 108208668 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTCCATTCCACCACGATAGAGC -3'
(R):5'- TGAGGATACCACTACCGACAAG -3'

Sequencing Primer
(F):5'- ATAGAGCCCCGAGTGATGTTC -3'
(R):5'- GCTCAAGCTGACCCTGAAG -3'
Posted On2015-04-02