Incidental Mutation 'R3765:Setd2'
ID 274661
Institutional Source Beutler Lab
Gene Symbol Setd2
Ensembl Gene ENSMUSG00000044791
Gene Name SET domain containing 2
Synonyms KMT3A, 4921524K10Rik
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.925) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 110361665-110447701 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110423314 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 345 (L345P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153838]
AlphaFold E9Q5F9
Predicted Effect probably damaging
Transcript: ENSMUST00000153838
AA Change: L2123P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: L2123P

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 156 176 N/A INTRINSIC
low complexity region 185 207 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 392 419 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
low complexity region 1015 1039 N/A INTRINSIC
low complexity region 1066 1077 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
AWS 1468 1523 8.39e-30 SMART
SET 1524 1647 3.07e-41 SMART
PostSET 1648 1664 1.27e-5 SMART
Blast:SET 1689 1714 2e-6 BLAST
low complexity region 1884 1909 N/A INTRINSIC
low complexity region 1956 1967 N/A INTRINSIC
coiled coil region 2090 2113 N/A INTRINSIC
low complexity region 2189 2211 N/A INTRINSIC
low complexity region 2248 2265 N/A INTRINSIC
WW 2363 2395 2.1e-11 SMART
Pfam:SRI 2440 2530 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196814
Predicted Effect probably benign
Transcript: ENSMUST00000197655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198697
Predicted Effect probably damaging
Transcript: ENSMUST00000200460
AA Change: L345P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Ccdc185 T A 1: 182,575,117 (GRCm39) H524L possibly damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Frk A G 10: 34,360,001 (GRCm39) M1V probably null Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prg4 G A 1: 150,327,122 (GRCm39) S898L probably damaging Het
Prmt6 C A 3: 110,157,510 (GRCm39) E260* probably null Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Sbf2 A G 7: 109,974,788 (GRCm39) V783A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Slc18b1 A G 10: 23,674,647 (GRCm39) D34G probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Slx4 A G 16: 3,798,850 (GRCm39) V1357A probably damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Tns3 G A 11: 8,401,133 (GRCm39) A1055V probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfhx3 A G 8: 109,519,394 (GRCm39) N172S probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Setd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Setd2 APN 9 110,380,204 (GRCm39) missense possibly damaging 0.94
IGL01023:Setd2 APN 9 110,376,581 (GRCm39) nonsense probably null
IGL01063:Setd2 APN 9 110,402,741 (GRCm39) missense probably damaging 1.00
IGL01745:Setd2 APN 9 110,423,779 (GRCm39) missense probably damaging 0.99
IGL01911:Setd2 APN 9 110,446,499 (GRCm39) splice site probably null
IGL01955:Setd2 APN 9 110,378,386 (GRCm39) missense probably benign 0.38
IGL02023:Setd2 APN 9 110,423,704 (GRCm39) missense probably benign 0.06
IGL02080:Setd2 APN 9 110,376,518 (GRCm39) splice site probably null
IGL02412:Setd2 APN 9 110,379,842 (GRCm39) missense probably benign 0.00
IGL02519:Setd2 APN 9 110,382,184 (GRCm39) missense probably damaging 0.97
IGL02631:Setd2 APN 9 110,379,644 (GRCm39) missense possibly damaging 0.80
IGL02754:Setd2 APN 9 110,379,124 (GRCm39) missense possibly damaging 0.77
IGL02828:Setd2 APN 9 110,390,282 (GRCm39) missense probably benign 0.31
IGL03033:Setd2 APN 9 110,380,343 (GRCm39) missense possibly damaging 0.96
IGL03140:Setd2 APN 9 110,444,020 (GRCm39) critical splice donor site probably null
IGL03378:Setd2 APN 9 110,382,220 (GRCm39) missense unknown
American_samoa UTSW 9 110,396,826 (GRCm39) nonsense probably null
slingshot UTSW 9 110,378,575 (GRCm39) missense probably benign 0.00
P0028:Setd2 UTSW 9 110,403,022 (GRCm39) missense probably benign 0.00
PIT4544001:Setd2 UTSW 9 110,380,232 (GRCm39) missense probably damaging 1.00
R0058:Setd2 UTSW 9 110,423,494 (GRCm39) missense probably damaging 0.98
R0058:Setd2 UTSW 9 110,423,494 (GRCm39) missense probably damaging 0.98
R0167:Setd2 UTSW 9 110,402,850 (GRCm39) missense probably damaging 1.00
R0408:Setd2 UTSW 9 110,423,310 (GRCm39) missense probably damaging 1.00
R0452:Setd2 UTSW 9 110,382,168 (GRCm39) splice site probably null
R0541:Setd2 UTSW 9 110,402,741 (GRCm39) missense probably damaging 1.00
R0947:Setd2 UTSW 9 110,377,579 (GRCm39) missense possibly damaging 0.87
R1249:Setd2 UTSW 9 110,402,948 (GRCm39) missense probably damaging 0.99
R1294:Setd2 UTSW 9 110,378,575 (GRCm39) missense probably benign 0.00
R1518:Setd2 UTSW 9 110,431,306 (GRCm39) missense probably damaging 0.98
R1585:Setd2 UTSW 9 110,380,464 (GRCm39) missense unknown
R1647:Setd2 UTSW 9 110,378,932 (GRCm39) missense probably benign 0.12
R1649:Setd2 UTSW 9 110,378,932 (GRCm39) missense probably benign 0.12
R1651:Setd2 UTSW 9 110,378,932 (GRCm39) missense probably benign 0.12
R1652:Setd2 UTSW 9 110,378,932 (GRCm39) missense probably benign 0.12
R1673:Setd2 UTSW 9 110,433,248 (GRCm39) missense probably damaging 0.97
R1703:Setd2 UTSW 9 110,378,932 (GRCm39) missense probably benign 0.12
R1706:Setd2 UTSW 9 110,378,932 (GRCm39) missense probably benign 0.12
R1709:Setd2 UTSW 9 110,378,925 (GRCm39) missense probably benign 0.00
R1752:Setd2 UTSW 9 110,423,673 (GRCm39) missense probably damaging 1.00
R1796:Setd2 UTSW 9 110,446,884 (GRCm39) critical splice acceptor site probably null
R1796:Setd2 UTSW 9 110,379,413 (GRCm39) missense probably benign 0.01
R1812:Setd2 UTSW 9 110,379,170 (GRCm39) missense probably damaging 0.99
R1884:Setd2 UTSW 9 110,385,486 (GRCm39) critical splice donor site probably null
R2024:Setd2 UTSW 9 110,378,201 (GRCm39) missense possibly damaging 0.65
R2051:Setd2 UTSW 9 110,379,958 (GRCm39) missense probably benign
R2117:Setd2 UTSW 9 110,433,212 (GRCm39) frame shift probably null
R2120:Setd2 UTSW 9 110,378,932 (GRCm39) missense probably benign 0.12
R2124:Setd2 UTSW 9 110,378,932 (GRCm39) missense probably benign 0.12
R2172:Setd2 UTSW 9 110,378,912 (GRCm39) missense probably benign 0.10
R2179:Setd2 UTSW 9 110,423,756 (GRCm39) nonsense probably null
R2262:Setd2 UTSW 9 110,390,311 (GRCm39) intron probably benign
R2411:Setd2 UTSW 9 110,379,497 (GRCm39) missense possibly damaging 0.46
R2413:Setd2 UTSW 9 110,376,572 (GRCm39) missense probably damaging 1.00
R2419:Setd2 UTSW 9 110,378,065 (GRCm39) missense possibly damaging 0.48
R2424:Setd2 UTSW 9 110,446,590 (GRCm39) missense probably benign 0.37
R3757:Setd2 UTSW 9 110,402,753 (GRCm39) missense probably damaging 0.99
R3796:Setd2 UTSW 9 110,378,639 (GRCm39) missense probably benign 0.00
R3797:Setd2 UTSW 9 110,378,639 (GRCm39) missense probably benign 0.00
R3799:Setd2 UTSW 9 110,378,639 (GRCm39) missense probably benign 0.00
R3899:Setd2 UTSW 9 110,421,586 (GRCm39) missense probably damaging 1.00
R3900:Setd2 UTSW 9 110,421,586 (GRCm39) missense probably damaging 1.00
R3913:Setd2 UTSW 9 110,380,114 (GRCm39) missense probably damaging 0.99
R4010:Setd2 UTSW 9 110,428,263 (GRCm39) missense probably null 1.00
R4580:Setd2 UTSW 9 110,403,311 (GRCm39) missense probably benign 0.06
R4614:Setd2 UTSW 9 110,398,881 (GRCm39) critical splice donor site probably null
R4651:Setd2 UTSW 9 110,423,200 (GRCm39) missense possibly damaging 0.53
R4652:Setd2 UTSW 9 110,423,200 (GRCm39) missense possibly damaging 0.53
R4855:Setd2 UTSW 9 110,401,022 (GRCm39) missense probably benign 0.02
R4970:Setd2 UTSW 9 110,377,226 (GRCm39) missense probably benign 0.28
R5112:Setd2 UTSW 9 110,377,226 (GRCm39) missense probably benign 0.28
R5123:Setd2 UTSW 9 110,446,595 (GRCm39) missense possibly damaging 0.76
R5140:Setd2 UTSW 9 110,380,197 (GRCm39) missense probably benign 0.00
R5202:Setd2 UTSW 9 110,380,298 (GRCm39) missense probably damaging 1.00
R5290:Setd2 UTSW 9 110,446,899 (GRCm39) missense probably damaging 1.00
R5560:Setd2 UTSW 9 110,378,907 (GRCm39) nonsense probably null
R5604:Setd2 UTSW 9 110,433,284 (GRCm39) missense probably damaging 0.99
R5678:Setd2 UTSW 9 110,431,254 (GRCm39) missense probably damaging 0.99
R5708:Setd2 UTSW 9 110,377,891 (GRCm39) missense possibly damaging 0.59
R5763:Setd2 UTSW 9 110,385,343 (GRCm39) splice site probably null
R5814:Setd2 UTSW 9 110,396,826 (GRCm39) nonsense probably null
R5924:Setd2 UTSW 9 110,403,112 (GRCm39) missense probably benign 0.23
R6244:Setd2 UTSW 9 110,377,733 (GRCm39) missense probably damaging 1.00
R6313:Setd2 UTSW 9 110,385,434 (GRCm39) missense unknown
R6431:Setd2 UTSW 9 110,379,453 (GRCm39) missense possibly damaging 0.65
R6526:Setd2 UTSW 9 110,361,785 (GRCm39) missense probably benign 0.33
R6579:Setd2 UTSW 9 110,378,846 (GRCm39) missense possibly damaging 0.87
R6996:Setd2 UTSW 9 110,379,640 (GRCm39) missense probably damaging 0.99
R7012:Setd2 UTSW 9 110,376,751 (GRCm39) missense probably damaging 0.97
R7105:Setd2 UTSW 9 110,377,328 (GRCm39) missense probably damaging 1.00
R7134:Setd2 UTSW 9 110,377,865 (GRCm39) missense possibly damaging 0.87
R7222:Setd2 UTSW 9 110,380,530 (GRCm39) missense
R7359:Setd2 UTSW 9 110,392,012 (GRCm39) missense
R7492:Setd2 UTSW 9 110,423,700 (GRCm39) missense
R7643:Setd2 UTSW 9 110,396,908 (GRCm39) splice site probably null
R7869:Setd2 UTSW 9 110,379,082 (GRCm39) nonsense probably null
R7903:Setd2 UTSW 9 110,446,905 (GRCm39) missense
R8004:Setd2 UTSW 9 110,421,613 (GRCm39) missense
R8017:Setd2 UTSW 9 110,431,255 (GRCm39) missense
R8019:Setd2 UTSW 9 110,431,255 (GRCm39) missense
R8366:Setd2 UTSW 9 110,377,816 (GRCm39) missense probably damaging 1.00
R8460:Setd2 UTSW 9 110,423,338 (GRCm39) missense
R8498:Setd2 UTSW 9 110,378,989 (GRCm39) missense probably damaging 0.99
R8725:Setd2 UTSW 9 110,402,912 (GRCm39) missense
R8870:Setd2 UTSW 9 110,423,321 (GRCm39) missense
R8878:Setd2 UTSW 9 110,421,467 (GRCm39) missense probably benign
R9132:Setd2 UTSW 9 110,374,385 (GRCm39) critical splice donor site probably null
R9159:Setd2 UTSW 9 110,374,385 (GRCm39) critical splice donor site probably null
R9198:Setd2 UTSW 9 110,378,168 (GRCm39) missense possibly damaging 0.77
R9277:Setd2 UTSW 9 110,379,619 (GRCm39) missense probably damaging 1.00
R9326:Setd2 UTSW 9 110,378,671 (GRCm39) missense probably benign 0.00
R9558:Setd2 UTSW 9 110,376,628 (GRCm39) missense probably damaging 0.99
R9664:Setd2 UTSW 9 110,377,570 (GRCm39) missense probably damaging 1.00
R9673:Setd2 UTSW 9 110,378,138 (GRCm39) missense probably damaging 1.00
RF009:Setd2 UTSW 9 110,379,779 (GRCm39) missense probably damaging 1.00
Z1176:Setd2 UTSW 9 110,376,343 (GRCm39) missense probably damaging 0.99
Z1176:Setd2 UTSW 9 110,361,794 (GRCm39) missense possibly damaging 0.85
Z1176:Setd2 UTSW 9 110,376,647 (GRCm39) missense probably damaging 0.97
Z1177:Setd2 UTSW 9 110,376,544 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATGATTAGTAACCTTTTGTGG -3'
(R):5'- CAGCAAGGGATTCTGTAGAATGTC -3'

Sequencing Primer
(F):5'- GAGCGCAGGAAGTTGTTT -3'
(R):5'- TCTGTAGAATGTCCTACCAAGGG -3'
Posted On 2015-04-02