Mutagenetix > Incidental Mutations

Incidental Mutation 'R3765:Setd2'

274661

Institutional Source

Beutler Lab

Gene Symbol

Setd2

Ensembl Gene

ENSMUSG00000044791

Gene Name

SET domain containing 2

Synonyms

4921524K10Rik, KMT3A

MMRRC Submission

040742-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R3765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110532597-110618633 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110594246 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 345 (L345P)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000153838]

Predicted Effect

probably damaging
Transcript: ENSMUST00000153838
AA Change: L2123P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: L2123P

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
low complexity region	156	176	N/A	INTRINSIC
low complexity region	185	207	N/A	INTRINSIC
low complexity region	297	313	N/A	INTRINSIC
low complexity region	392	419	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
low complexity region	867	883	N/A	INTRINSIC
low complexity region	1015	1039	N/A	INTRINSIC
low complexity region	1066	1077	N/A	INTRINSIC
low complexity region	1384	1395	N/A	INTRINSIC
AWS	1468	1523	8.39e-30	SMART
SET	1524	1647	3.07e-41	SMART
PostSET	1648	1664	1.27e-5	SMART
Blast:SET	1689	1714	2e-6	BLAST
low complexity region	1884	1909	N/A	INTRINSIC
low complexity region	1956	1967	N/A	INTRINSIC
coiled coil region	2090	2113	N/A	INTRINSIC
low complexity region	2189	2211	N/A	INTRINSIC
low complexity region	2248	2265	N/A	INTRINSIC
WW	2363	2395	2.1e-11	SMART
Pfam:SRI	2440	2530	6e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196814

Predicted Effect

probably benign
Transcript: ENSMUST00000197655

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198697

Predicted Effect

probably damaging
Transcript: ENSMUST00000200460
AA Change: L345P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap13	T	C	7: 75,608,837	V403A	probably benign	Het
Arid2	T	C	15: 96,370,714	S903P	probably benign	Het
Arl6ip6	T	A	2: 53,192,231	W37R	probably damaging	Het
Bag3	C	T	7: 128,540,271	T162I	probably benign	Het
C4b	G	A	17: 34,729,840	P1545S	probably damaging	Het
Ccdc185	T	A	1: 182,747,552	H524L	possibly damaging	Het
Cfap43	T	C	19: 47,835,575	N119S	probably benign	Het
Churc1	C	A	12: 76,773,283	S22*	probably null	Het
Crbn	T	C	6: 106,795,026	K106E	possibly damaging	Het
Dag1	C	T	9: 108,208,199	G581E	probably damaging	Het
Dpp4	T	A	2: 62,386,436	T92S	probably benign	Het
Fam135a	T	C	1: 24,055,877	T137A	possibly damaging	Het
Fermt1	T	C	2: 132,906,702	D667G	possibly damaging	Het
Foxl2	T	A	9: 98,955,986	I109N	probably damaging	Het
Frk	A	G	10: 34,484,005	M1V	probably null	Het
Fuk	A	G	8: 110,887,104	I775T	probably benign	Het
Gstm2	A	G	3: 107,984,030	F124S	probably damaging	Het
Hmcn1	T	C	1: 150,745,025	S1145G	possibly damaging	Het
Ints10	A	G	8: 68,825,119	T682A	possibly damaging	Het
Jmy	T	C	13: 93,464,711	M396V	possibly damaging	Het
Ldb3	A	T	14: 34,578,682		probably null	Het
Mre11a	A	G	9: 14,809,847	N354S	probably benign	Het
Nbea	A	G	3: 56,005,549	V939A	probably damaging	Het
Nphs1	T	C	7: 30,471,210	S928P	probably damaging	Het
Olfr1463	G	A	19: 13,234,431	M60I	probably damaging	Het
Olfr19	A	G	16: 16,673,315	V222A	probably benign	Het
Olfr311	T	C	11: 58,841,294	F60S	probably damaging	Het
Olfr954	T	A	9: 39,461,624	Y61*	probably null	Het
Pla2g12b	G	A	10: 59,421,501	V169M	probably damaging	Het
Polr1c	C	T	17: 46,247,924	V14M	probably damaging	Het
Prg4	G	A	1: 150,451,371	S898L	probably damaging	Het
Prmt6	C	A	3: 110,250,194	E260*	probably null	Het
Ptx4	A	G	17: 25,122,868	T106A	probably benign	Het
Rab3il1	A	G	19: 10,028,309	T87A	probably damaging	Het
Sbf2	A	G	7: 110,375,581	V783A	probably damaging	Het
Scn2a	A	C	2: 65,682,710	D209A	possibly damaging	Het
Slc18b1	A	G	10: 23,798,749	D34G	probably damaging	Het
Slc9c1	A	T	16: 45,590,881	M934L	possibly damaging	Het
Slx4	A	G	16: 3,980,986	V1357A	probably damaging	Het
Spidr	T	C	16: 15,968,640	E413G	probably benign	Het
Taar1	A	G	10: 23,921,307	Y301C	probably damaging	Het
Tada2b	A	T	5: 36,476,417	D197E	probably benign	Het
Taf1c	G	T	8: 119,600,485	Y418*	probably null	Het
Tanc2	A	G	11: 105,914,970	D394G	probably damaging	Het
Tnpo3	T	C	6: 29,579,689	D235G	probably benign	Het
Tns3	G	A	11: 8,451,133	A1055V	probably benign	Het
Wdfy3	A	G	5: 101,861,400	Y2767H	probably damaging	Het
Zfhx3	A	G	8: 108,792,762	N172S	probably damaging	Het
Zfp839	T	C	12: 110,855,163	V137A	probably benign	Het

Other mutations in Setd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00722:Setd2	APN	9	110551136	missense	possibly damaging	0.94
IGL01023:Setd2	APN	9	110547513	nonsense	probably null
IGL01063:Setd2	APN	9	110573673	missense	probably damaging	1.00
IGL01745:Setd2	APN	9	110594711	missense	probably damaging	0.99
IGL01911:Setd2	APN	9	110617431	splice site	probably null
IGL01955:Setd2	APN	9	110549318	missense	probably benign	0.38
IGL02023:Setd2	APN	9	110594636	missense	probably benign	0.06
IGL02080:Setd2	APN	9	110547450	splice site	probably null
IGL02412:Setd2	APN	9	110550774	missense	probably benign	0.00
IGL02519:Setd2	APN	9	110553116	missense	probably damaging	0.97
IGL02631:Setd2	APN	9	110550576	missense	possibly damaging	0.80
IGL02754:Setd2	APN	9	110550056	missense	possibly damaging	0.77
IGL02828:Setd2	APN	9	110561214	missense	probably benign	0.31
IGL03033:Setd2	APN	9	110551275	missense	possibly damaging	0.96
IGL03140:Setd2	APN	9	110614952	critical splice donor site	probably null
IGL03378:Setd2	APN	9	110553152	missense	unknown
American_samoa	UTSW	9	110567758	nonsense	probably null
slingshot	UTSW	9	110549507	missense	probably benign	0.00
P0028:Setd2	UTSW	9	110573954	missense	probably benign	0.00
PIT4544001:Setd2	UTSW	9	110551164	missense	probably damaging	1.00
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0058:Setd2	UTSW	9	110594426	missense	probably damaging	0.98
R0167:Setd2	UTSW	9	110573782	missense	probably damaging	1.00
R0408:Setd2	UTSW	9	110594242	missense	probably damaging	1.00
R0452:Setd2	UTSW	9	110553100	splice site	probably null
R0541:Setd2	UTSW	9	110573673	missense	probably damaging	1.00
R0947:Setd2	UTSW	9	110548511	missense	possibly damaging	0.87
R1249:Setd2	UTSW	9	110573880	missense	probably damaging	0.99
R1294:Setd2	UTSW	9	110549507	missense	probably benign	0.00
R1518:Setd2	UTSW	9	110602238	missense	probably damaging	0.98
R1585:Setd2	UTSW	9	110551396	missense	unknown
R1647:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1649:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1651:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1652:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1673:Setd2	UTSW	9	110604180	missense	probably damaging	0.97
R1703:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1706:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R1709:Setd2	UTSW	9	110549857	missense	probably benign	0.00
R1752:Setd2	UTSW	9	110594605	missense	probably damaging	1.00
R1796:Setd2	UTSW	9	110550345	missense	probably benign	0.01
R1796:Setd2	UTSW	9	110617816	critical splice acceptor site	probably null
R1812:Setd2	UTSW	9	110550102	missense	probably damaging	0.99
R1884:Setd2	UTSW	9	110556418	critical splice donor site	probably null
R2024:Setd2	UTSW	9	110549133	missense	possibly damaging	0.65
R2051:Setd2	UTSW	9	110550890	missense	probably benign
R2117:Setd2	UTSW	9	110604144	frame shift	probably null
R2120:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2124:Setd2	UTSW	9	110549864	missense	probably benign	0.12
R2172:Setd2	UTSW	9	110549844	missense	probably benign	0.10
R2179:Setd2	UTSW	9	110594688	nonsense	probably null
R2262:Setd2	UTSW	9	110561243	intron	probably benign
R2411:Setd2	UTSW	9	110550429	missense	possibly damaging	0.46
R2413:Setd2	UTSW	9	110547504	missense	probably damaging	1.00
R2419:Setd2	UTSW	9	110548997	missense	possibly damaging	0.48
R2424:Setd2	UTSW	9	110617522	missense	probably benign	0.37
R3757:Setd2	UTSW	9	110573685	missense	probably damaging	0.99
R3796:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3797:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3799:Setd2	UTSW	9	110549571	missense	probably benign	0.00
R3899:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3900:Setd2	UTSW	9	110592518	missense	probably damaging	1.00
R3913:Setd2	UTSW	9	110551046	missense	probably damaging	0.99
R4010:Setd2	UTSW	9	110599195	missense	probably null	1.00
R4580:Setd2	UTSW	9	110574243	missense	probably benign	0.06
R4614:Setd2	UTSW	9	110569813	critical splice donor site	probably null
R4651:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4652:Setd2	UTSW	9	110594132	missense	possibly damaging	0.53
R4855:Setd2	UTSW	9	110571954	missense	probably benign	0.02
R4970:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5112:Setd2	UTSW	9	110548158	missense	probably benign	0.28
R5123:Setd2	UTSW	9	110617527	missense	possibly damaging	0.76
R5140:Setd2	UTSW	9	110551129	missense	probably benign	0.00
R5202:Setd2	UTSW	9	110551230	missense	probably damaging	1.00
R5290:Setd2	UTSW	9	110617831	missense	probably damaging	1.00
R5560:Setd2	UTSW	9	110549839	nonsense	probably null
R5604:Setd2	UTSW	9	110604216	missense	probably damaging	0.99
R5678:Setd2	UTSW	9	110602186	missense	probably damaging	0.99
R5708:Setd2	UTSW	9	110548823	missense	possibly damaging	0.59
R5763:Setd2	UTSW	9	110556275	splice site	probably null
R5814:Setd2	UTSW	9	110567758	nonsense	probably null
R5924:Setd2	UTSW	9	110574044	missense	probably benign	0.23
R6244:Setd2	UTSW	9	110548665	missense	probably damaging	1.00
R6313:Setd2	UTSW	9	110556366	missense	unknown
R6431:Setd2	UTSW	9	110550385	missense	possibly damaging	0.65
R6526:Setd2	UTSW	9	110532717	missense	probably benign	0.33
R6579:Setd2	UTSW	9	110549778	missense	possibly damaging	0.87
R6996:Setd2	UTSW	9	110550572	missense	probably damaging	0.99
R7012:Setd2	UTSW	9	110547683	missense	probably damaging	0.97
R7105:Setd2	UTSW	9	110548260	missense	probably damaging	1.00
R7134:Setd2	UTSW	9	110548797	missense	possibly damaging	0.87
R7222:Setd2	UTSW	9	110551462	missense
R7359:Setd2	UTSW	9	110562944	missense
R7492:Setd2	UTSW	9	110594632	missense
R7643:Setd2	UTSW	9	110567840	splice site	probably null
R7869:Setd2	UTSW	9	110550014	nonsense	probably null
R7903:Setd2	UTSW	9	110617837	missense
R8004:Setd2	UTSW	9	110592545	missense
R8017:Setd2	UTSW	9	110602187	missense
R8019:Setd2	UTSW	9	110602187	missense
R8366:Setd2	UTSW	9	110548748	missense	probably damaging	1.00
R8460:Setd2	UTSW	9	110594270	missense
R8498:Setd2	UTSW	9	110549921	missense	probably damaging	0.99
R8725:Setd2	UTSW	9	110573844	missense
R8870:Setd2	UTSW	9	110594253	missense
R8878:Setd2	UTSW	9	110592399	missense	probably benign
RF009:Setd2	UTSW	9	110550711	missense	probably damaging	1.00
Z1176:Setd2	UTSW	9	110532726	missense	possibly damaging	0.85
Z1176:Setd2	UTSW	9	110547275	missense	probably damaging	0.99
Z1176:Setd2	UTSW	9	110547579	missense	probably damaging	0.97
Z1177:Setd2	UTSW	9	110547476	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCATGATTAGTAACCTTTTGTGG -3'
(R):5'- CAGCAAGGGATTCTGTAGAATGTC -3'

Sequencing Primer
(F):5'- GAGCGCAGGAAGTTGTTT -3'
(R):5'- TCTGTAGAATGTCCTACCAAGGG -3'

Posted On

2015-04-02