Incidental Mutation 'R3765:Slc18b1'
ID274662
Institutional Source Beutler Lab
Gene Symbol Slc18b1
Ensembl Gene ENSMUSG00000037455
Gene Namesolute carrier family 18, subfamily B, member 1
Synonyms1110021L09Rik
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23796986-23827968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23798749 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 34 (D34G)
Ref Sequence ENSEMBL: ENSMUSP00000121289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119597] [ENSMUST00000133289] [ENSMUST00000134170] [ENSMUST00000179321]
Predicted Effect unknown
Transcript: ENSMUST00000119597
AA Change: D16G
SMART Domains Protein: ENSMUSP00000112634
Gene: ENSMUSG00000037455
AA Change: D16G

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 254 3.2e-26 PFAM
Pfam:MFS_1 237 454 7.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133289
AA Change: D34G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121289
Gene: ENSMUSG00000037455
AA Change: D34G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134170
AA Change: D16G
SMART Domains Protein: ENSMUSP00000116940
Gene: ENSMUSG00000037455
AA Change: D16G

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 129 1.4e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000179321
AA Change: D16G
SMART Domains Protein: ENSMUSP00000137431
Gene: ENSMUSG00000037455
AA Change: D16G

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 262 2.4e-26 PFAM
Pfam:LacY_symp 226 454 3.9e-8 PFAM
Pfam:MFS_1 241 456 4.9e-23 PFAM
Pfam:MFS_2 253 458 3.7e-9 PFAM
Meta Mutation Damage Score 0.0622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, which has high sequence similarity to rat, xenopus and zebrafish proteins. The protein function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Slc18b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Slc18b1 APN 10 23824761 critical splice donor site probably null
IGL01474:Slc18b1 APN 10 23803850 missense probably benign 0.35
IGL01788:Slc18b1 APN 10 23826001 missense probably damaging 0.96
IGL02660:Slc18b1 APN 10 23810952 splice site probably benign
IGL03049:Slc18b1 APN 10 23822946 missense probably benign 0.01
IGL03106:Slc18b1 APN 10 23826659 makesense probably null
R0440:Slc18b1 UTSW 10 23819078 missense probably benign 0.16
R0633:Slc18b1 UTSW 10 23806038 missense probably benign 0.00
R1086:Slc18b1 UTSW 10 23803795 missense probably benign 0.02
R1572:Slc18b1 UTSW 10 23798741 splice site probably benign
R1842:Slc18b1 UTSW 10 23805993 missense possibly damaging 0.87
R2256:Slc18b1 UTSW 10 23810922 missense probably benign 0.25
R3423:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3424:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3425:Slc18b1 UTSW 10 23822976 missense probably damaging 0.99
R3766:Slc18b1 UTSW 10 23798749 missense probably damaging 0.99
R4063:Slc18b1 UTSW 10 23805981 missense probably benign 0.01
R4779:Slc18b1 UTSW 10 23820869 missense possibly damaging 0.71
R5714:Slc18b1 UTSW 10 23798766 missense probably benign 0.00
R5910:Slc18b1 UTSW 10 23824667 intron probably benign
R6084:Slc18b1 UTSW 10 23804212 missense probably benign 0.15
R6789:Slc18b1 UTSW 10 23816329 missense probably benign 0.02
R6868:Slc18b1 UTSW 10 23804234 missense possibly damaging 0.95
R6959:Slc18b1 UTSW 10 23826044 splice site probably null
R7632:Slc18b1 UTSW 10 23826182 missense probably benign
R8101:Slc18b1 UTSW 10 23822943 missense probably damaging 1.00
R8838:Slc18b1 UTSW 10 23820866 missense probably benign 0.25
R8868:Slc18b1 UTSW 10 23810853 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAAGCAGTCGAAATGGCTT -3'
(R):5'- TCTCTAAAATTATATAGCTGAAGGGCT -3'

Sequencing Primer
(F):5'- GTTGAAATTCTAACGGAAGAGTCTCC -3'
(R):5'- GCTGAAGGGCTTTCTAAAAATTAGAG -3'
Posted On2015-04-02