Incidental Mutation 'R3765:Slc18b1'
ID 274662
Institutional Source Beutler Lab
Gene Symbol Slc18b1
Ensembl Gene ENSMUSG00000037455
Gene Name solute carrier family 18, subfamily B, member 1
Synonyms 1110021L09Rik
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 23672884-23703866 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23674647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 34 (D34G)
Ref Sequence ENSEMBL: ENSMUSP00000121289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119597] [ENSMUST00000133289] [ENSMUST00000134170] [ENSMUST00000179321]
AlphaFold D3Z5L6
Predicted Effect unknown
Transcript: ENSMUST00000119597
AA Change: D16G
SMART Domains Protein: ENSMUSP00000112634
Gene: ENSMUSG00000037455
AA Change: D16G

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 254 3.2e-26 PFAM
Pfam:MFS_1 237 454 7.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133289
AA Change: D34G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121289
Gene: ENSMUSG00000037455
AA Change: D34G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000134170
AA Change: D16G
SMART Domains Protein: ENSMUSP00000116940
Gene: ENSMUSG00000037455
AA Change: D16G

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 129 1.4e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000179321
AA Change: D16G
SMART Domains Protein: ENSMUSP00000137431
Gene: ENSMUSG00000037455
AA Change: D16G

DomainStartEndE-ValueType
low complexity region 4 32 N/A INTRINSIC
Pfam:MFS_1 40 262 2.4e-26 PFAM
Pfam:LacY_symp 226 454 3.9e-8 PFAM
Pfam:MFS_1 241 456 4.9e-23 PFAM
Pfam:MFS_2 253 458 3.7e-9 PFAM
Meta Mutation Damage Score 0.0622 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, which has high sequence similarity to rat, xenopus and zebrafish proteins. The protein function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Ccdc185 T A 1: 182,575,117 (GRCm39) H524L possibly damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Frk A G 10: 34,360,001 (GRCm39) M1V probably null Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prg4 G A 1: 150,327,122 (GRCm39) S898L probably damaging Het
Prmt6 C A 3: 110,157,510 (GRCm39) E260* probably null Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Sbf2 A G 7: 109,974,788 (GRCm39) V783A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Setd2 T C 9: 110,423,314 (GRCm39) L345P probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Slx4 A G 16: 3,798,850 (GRCm39) V1357A probably damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Tns3 G A 11: 8,401,133 (GRCm39) A1055V probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfhx3 A G 8: 109,519,394 (GRCm39) N172S probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Slc18b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Slc18b1 APN 10 23,700,659 (GRCm39) critical splice donor site probably null
IGL01474:Slc18b1 APN 10 23,679,748 (GRCm39) missense probably benign 0.35
IGL01788:Slc18b1 APN 10 23,701,899 (GRCm39) missense probably damaging 0.96
IGL02660:Slc18b1 APN 10 23,686,850 (GRCm39) splice site probably benign
IGL03049:Slc18b1 APN 10 23,698,844 (GRCm39) missense probably benign 0.01
IGL03106:Slc18b1 APN 10 23,702,557 (GRCm39) makesense probably null
R0440:Slc18b1 UTSW 10 23,694,976 (GRCm39) missense probably benign 0.16
R0633:Slc18b1 UTSW 10 23,681,936 (GRCm39) missense probably benign 0.00
R1086:Slc18b1 UTSW 10 23,679,693 (GRCm39) missense probably benign 0.02
R1572:Slc18b1 UTSW 10 23,674,639 (GRCm39) splice site probably benign
R1842:Slc18b1 UTSW 10 23,681,891 (GRCm39) missense possibly damaging 0.87
R2256:Slc18b1 UTSW 10 23,686,820 (GRCm39) missense probably benign 0.25
R3423:Slc18b1 UTSW 10 23,698,874 (GRCm39) missense probably damaging 0.99
R3424:Slc18b1 UTSW 10 23,698,874 (GRCm39) missense probably damaging 0.99
R3425:Slc18b1 UTSW 10 23,698,874 (GRCm39) missense probably damaging 0.99
R3766:Slc18b1 UTSW 10 23,674,647 (GRCm39) missense probably damaging 0.99
R4063:Slc18b1 UTSW 10 23,681,879 (GRCm39) missense probably benign 0.01
R4779:Slc18b1 UTSW 10 23,696,767 (GRCm39) missense possibly damaging 0.71
R5714:Slc18b1 UTSW 10 23,674,664 (GRCm39) missense probably benign 0.00
R5910:Slc18b1 UTSW 10 23,700,565 (GRCm39) intron probably benign
R6084:Slc18b1 UTSW 10 23,680,110 (GRCm39) missense probably benign 0.15
R6789:Slc18b1 UTSW 10 23,692,227 (GRCm39) missense probably benign 0.02
R6868:Slc18b1 UTSW 10 23,680,132 (GRCm39) missense possibly damaging 0.95
R6959:Slc18b1 UTSW 10 23,701,942 (GRCm39) splice site probably null
R7632:Slc18b1 UTSW 10 23,702,080 (GRCm39) missense probably benign
R8101:Slc18b1 UTSW 10 23,698,841 (GRCm39) missense probably damaging 1.00
R8757:Slc18b1 UTSW 10 23,692,198 (GRCm39) synonymous silent
R8838:Slc18b1 UTSW 10 23,696,764 (GRCm39) missense probably benign 0.25
R8868:Slc18b1 UTSW 10 23,686,751 (GRCm39) missense probably damaging 0.98
R9112:Slc18b1 UTSW 10 23,692,262 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAAGCAGTCGAAATGGCTT -3'
(R):5'- TCTCTAAAATTATATAGCTGAAGGGCT -3'

Sequencing Primer
(F):5'- GTTGAAATTCTAACGGAAGAGTCTCC -3'
(R):5'- GCTGAAGGGCTTTCTAAAAATTAGAG -3'
Posted On 2015-04-02