Incidental Mutation 'R3765:Frk'
ID 274664
Institutional Source Beutler Lab
Gene Symbol Frk
Ensembl Gene ENSMUSG00000019779
Gene Name fyn-related kinase
Synonyms BSK/IYK, GTK
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.206) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 34359395-34487274 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to G at 34360001 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000130289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019913] [ENSMUST00000170771]
AlphaFold Q922K9
Predicted Effect probably null
Transcript: ENSMUST00000019913
AA Change: M1V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019913
Gene: ENSMUSG00000019779
AA Change: M1V

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170771
AA Change: M1V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130289
Gene: ENSMUSG00000019779
AA Change: M1V

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215594
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during G1 and S phase of the cell cycle and suppress growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit increased susceptibility to spontaneous tumors nor increased sensitivity to inoizing radiation. Epithelial tissues appear similar to controls, but circulating levels of T3 were significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Ccdc185 T A 1: 182,575,117 (GRCm39) H524L possibly damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prg4 G A 1: 150,327,122 (GRCm39) S898L probably damaging Het
Prmt6 C A 3: 110,157,510 (GRCm39) E260* probably null Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Sbf2 A G 7: 109,974,788 (GRCm39) V783A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Setd2 T C 9: 110,423,314 (GRCm39) L345P probably damaging Het
Slc18b1 A G 10: 23,674,647 (GRCm39) D34G probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Slx4 A G 16: 3,798,850 (GRCm39) V1357A probably damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Tns3 G A 11: 8,401,133 (GRCm39) A1055V probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfhx3 A G 8: 109,519,394 (GRCm39) N172S probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Frk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Frk APN 10 34,360,239 (GRCm39) missense probably damaging 0.98
IGL01402:Frk APN 10 34,423,381 (GRCm39) missense probably damaging 1.00
IGL02197:Frk APN 10 34,360,330 (GRCm39) missense probably damaging 1.00
IGL02289:Frk APN 10 34,360,362 (GRCm39) missense probably damaging 0.99
IGL02618:Frk APN 10 34,459,960 (GRCm39) missense possibly damaging 0.88
IGL02885:Frk APN 10 34,360,067 (GRCm39) missense probably benign 0.03
IGL03256:Frk APN 10 34,483,838 (GRCm39) missense probably benign 0.00
R0299:Frk UTSW 10 34,360,367 (GRCm39) critical splice donor site probably null
R0697:Frk UTSW 10 34,483,833 (GRCm39) missense probably benign 0.12
R1033:Frk UTSW 10 34,484,454 (GRCm39) missense probably damaging 1.00
R1583:Frk UTSW 10 34,467,806 (GRCm39) critical splice acceptor site probably null
R1793:Frk UTSW 10 34,483,878 (GRCm39) missense probably benign 0.05
R2248:Frk UTSW 10 34,484,527 (GRCm39) missense probably benign 0.10
R3084:Frk UTSW 10 34,483,950 (GRCm39) missense probably damaging 1.00
R3086:Frk UTSW 10 34,483,950 (GRCm39) missense probably damaging 1.00
R3766:Frk UTSW 10 34,360,001 (GRCm39) start codon destroyed probably null 0.98
R3906:Frk UTSW 10 34,460,052 (GRCm39) missense probably benign 0.00
R4163:Frk UTSW 10 34,467,868 (GRCm39) missense probably damaging 0.98
R4486:Frk UTSW 10 34,484,377 (GRCm39) missense probably benign 0.10
R4591:Frk UTSW 10 34,481,829 (GRCm39) missense probably benign 0.03
R4821:Frk UTSW 10 34,360,233 (GRCm39) missense probably benign 0.01
R5070:Frk UTSW 10 34,360,280 (GRCm39) nonsense probably null
R6172:Frk UTSW 10 34,467,961 (GRCm39) missense probably damaging 1.00
R6572:Frk UTSW 10 34,459,963 (GRCm39) missense probably benign 0.00
R6619:Frk UTSW 10 34,481,835 (GRCm39) missense probably benign 0.22
R7307:Frk UTSW 10 34,467,934 (GRCm39) missense probably damaging 1.00
R7486:Frk UTSW 10 34,423,292 (GRCm39) nonsense probably null
R7916:Frk UTSW 10 34,360,021 (GRCm39) missense possibly damaging 0.74
R8341:Frk UTSW 10 34,462,279 (GRCm39) missense probably damaging 1.00
R8675:Frk UTSW 10 34,484,493 (GRCm39) missense probably benign 0.00
R8801:Frk UTSW 10 34,423,402 (GRCm39) missense possibly damaging 0.78
R9608:Frk UTSW 10 34,481,873 (GRCm39) critical splice donor site probably null
Z1177:Frk UTSW 10 34,460,001 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGAGTGTCTTGGCCAAG -3'
(R):5'- AGACTTGGAGTTTGTCGCC -3'

Sequencing Primer
(F):5'- AAGCCCAGATCTGCCGGAG -3'
(R):5'- CGTGCTTGGTAATCAAACAGAGCC -3'
Posted On 2015-04-02