Incidental Mutation 'R3765:Frk'
ID 274664
Institutional Source Beutler Lab
Gene Symbol Frk
Ensembl Gene ENSMUSG00000019779
Gene Name fyn-related kinase
Synonyms GTK, BSK/IYK
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 34483399-34611278 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to G at 34484005 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000130289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019913] [ENSMUST00000170771]
AlphaFold Q922K9
Predicted Effect probably null
Transcript: ENSMUST00000019913
AA Change: M1V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019913
Gene: ENSMUSG00000019779
AA Change: M1V

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170771
AA Change: M1V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130289
Gene: ENSMUSG00000019779
AA Change: M1V

DomainStartEndE-ValueType
SH3 52 116 2.76e-19 SMART
SH2 121 206 4.97e-37 SMART
TyrKc 241 494 8.58e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215594
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during G1 and S phase of the cell cycle and suppress growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit increased susceptibility to spontaneous tumors nor increased sensitivity to inoizing radiation. Epithelial tissues appear similar to controls, but circulating levels of T3 were significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Frk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Frk APN 10 34484243 missense probably damaging 0.98
IGL01402:Frk APN 10 34547385 missense probably damaging 1.00
IGL02197:Frk APN 10 34484334 missense probably damaging 1.00
IGL02289:Frk APN 10 34484366 missense probably damaging 0.99
IGL02618:Frk APN 10 34583964 missense possibly damaging 0.88
IGL02885:Frk APN 10 34484071 missense probably benign 0.03
IGL03256:Frk APN 10 34607842 missense probably benign 0.00
R0299:Frk UTSW 10 34484371 critical splice donor site probably null
R0697:Frk UTSW 10 34607837 missense probably benign 0.12
R1033:Frk UTSW 10 34608458 missense probably damaging 1.00
R1583:Frk UTSW 10 34591810 critical splice acceptor site probably null
R1793:Frk UTSW 10 34607882 missense probably benign 0.05
R2248:Frk UTSW 10 34608531 missense probably benign 0.10
R3084:Frk UTSW 10 34607954 missense probably damaging 1.00
R3086:Frk UTSW 10 34607954 missense probably damaging 1.00
R3766:Frk UTSW 10 34484005 start codon destroyed probably null 0.98
R3906:Frk UTSW 10 34584056 missense probably benign 0.00
R4163:Frk UTSW 10 34591872 missense probably damaging 0.98
R4486:Frk UTSW 10 34608381 missense probably benign 0.10
R4591:Frk UTSW 10 34605833 missense probably benign 0.03
R4821:Frk UTSW 10 34484237 missense probably benign 0.01
R5070:Frk UTSW 10 34484284 nonsense probably null
R6172:Frk UTSW 10 34591965 missense probably damaging 1.00
R6572:Frk UTSW 10 34583967 missense probably benign 0.00
R6619:Frk UTSW 10 34605839 missense probably benign 0.22
R7307:Frk UTSW 10 34591938 missense probably damaging 1.00
R7486:Frk UTSW 10 34547296 nonsense probably null
R7916:Frk UTSW 10 34484025 missense possibly damaging 0.74
R8341:Frk UTSW 10 34586283 missense probably damaging 1.00
R8675:Frk UTSW 10 34608497 missense probably benign 0.00
R8801:Frk UTSW 10 34547406 missense possibly damaging 0.78
R9608:Frk UTSW 10 34605877 critical splice donor site probably null
Z1177:Frk UTSW 10 34584005 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGAGTGTCTTGGCCAAG -3'
(R):5'- AGACTTGGAGTTTGTCGCC -3'

Sequencing Primer
(F):5'- AAGCCCAGATCTGCCGGAG -3'
(R):5'- CGTGCTTGGTAATCAAACAGAGCC -3'
Posted On 2015-04-02