Incidental Mutation 'R3765:Tns3'
ID 274666
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Name tensin 3
Synonyms F830010I22Rik, Tens1, TEM6
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.327) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 8381652-8614681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 8401133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1055 (A1055V)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
AlphaFold Q5SSZ5
Predicted Effect probably benign
Transcript: ENSMUST00000020695
AA Change: A1055V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: A1055V

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129074
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Ccdc185 T A 1: 182,575,117 (GRCm39) H524L possibly damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Frk A G 10: 34,360,001 (GRCm39) M1V probably null Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prg4 G A 1: 150,327,122 (GRCm39) S898L probably damaging Het
Prmt6 C A 3: 110,157,510 (GRCm39) E260* probably null Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Sbf2 A G 7: 109,974,788 (GRCm39) V783A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Setd2 T C 9: 110,423,314 (GRCm39) L345P probably damaging Het
Slc18b1 A G 10: 23,674,647 (GRCm39) D34G probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Slx4 A G 16: 3,798,850 (GRCm39) V1357A probably damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfhx3 A G 8: 109,519,394 (GRCm39) N172S probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8,401,066 (GRCm39) missense probably benign 0.42
IGL00822:Tns3 APN 11 8,393,976 (GRCm39) missense probably damaging 0.99
IGL01075:Tns3 APN 11 8,428,399 (GRCm39) missense probably benign 0.45
IGL01286:Tns3 APN 11 8,442,617 (GRCm39) missense probably benign 0.01
IGL01680:Tns3 APN 11 8,498,937 (GRCm39) missense probably damaging 1.00
IGL01687:Tns3 APN 11 8,442,798 (GRCm39) missense probably damaging 1.00
IGL01734:Tns3 APN 11 8,469,192 (GRCm39) splice site probably benign
IGL01844:Tns3 APN 11 8,387,177 (GRCm39) missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8,498,992 (GRCm39) nonsense probably null
IGL02137:Tns3 APN 11 8,442,578 (GRCm39) missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8,384,531 (GRCm39) missense probably damaging 1.00
IGL02623:Tns3 APN 11 8,387,141 (GRCm39) missense probably damaging 1.00
IGL02697:Tns3 APN 11 8,442,346 (GRCm39) missense probably benign 0.00
IGL02829:Tns3 APN 11 8,469,564 (GRCm39) missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8,442,149 (GRCm39) missense probably benign 0.38
R0020:Tns3 UTSW 11 8,495,227 (GRCm39) critical splice donor site probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0370:Tns3 UTSW 11 8,395,730 (GRCm39) missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8,395,703 (GRCm39) missense probably benign 0.07
R0410:Tns3 UTSW 11 8,385,852 (GRCm39) missense probably benign 0.02
R0496:Tns3 UTSW 11 8,497,262 (GRCm39) splice site probably benign
R0562:Tns3 UTSW 11 8,443,262 (GRCm39) missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8,443,121 (GRCm39) missense probably benign 0.04
R0736:Tns3 UTSW 11 8,469,474 (GRCm39) missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8,443,302 (GRCm39) missense probably damaging 1.00
R1367:Tns3 UTSW 11 8,398,704 (GRCm39) missense probably benign 0.01
R1386:Tns3 UTSW 11 8,468,261 (GRCm39) missense probably benign 0.02
R1975:Tns3 UTSW 11 8,385,738 (GRCm39) missense probably benign 0.04
R2205:Tns3 UTSW 11 8,481,719 (GRCm39) missense probably damaging 1.00
R2319:Tns3 UTSW 11 8,491,200 (GRCm39) missense probably damaging 1.00
R2830:Tns3 UTSW 11 8,385,870 (GRCm39) missense probably damaging 1.00
R3720:Tns3 UTSW 11 8,442,999 (GRCm39) missense probably damaging 1.00
R3817:Tns3 UTSW 11 8,384,619 (GRCm39) missense probably damaging 1.00
R4058:Tns3 UTSW 11 8,442,275 (GRCm39) missense probably damaging 1.00
R4599:Tns3 UTSW 11 8,481,747 (GRCm39) missense probably damaging 1.00
R4631:Tns3 UTSW 11 8,401,119 (GRCm39) missense probably benign 0.30
R4731:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4732:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4733:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R5472:Tns3 UTSW 11 8,401,092 (GRCm39) missense probably benign
R5749:Tns3 UTSW 11 8,401,177 (GRCm39) missense probably benign 0.01
R5807:Tns3 UTSW 11 8,443,211 (GRCm39) missense probably damaging 1.00
R5844:Tns3 UTSW 11 8,384,580 (GRCm39) missense probably damaging 1.00
R5942:Tns3 UTSW 11 8,385,860 (GRCm39) missense probably damaging 1.00
R5982:Tns3 UTSW 11 8,442,245 (GRCm39) missense probably damaging 0.99
R6025:Tns3 UTSW 11 8,442,578 (GRCm39) missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8,442,987 (GRCm39) missense probably damaging 1.00
R6322:Tns3 UTSW 11 8,442,147 (GRCm39) missense probably benign 0.01
R6536:Tns3 UTSW 11 8,384,531 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,058 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,057 (GRCm39) missense probably damaging 1.00
R6864:Tns3 UTSW 11 8,443,196 (GRCm39) missense probably damaging 1.00
R6897:Tns3 UTSW 11 8,481,743 (GRCm39) missense probably damaging 1.00
R7108:Tns3 UTSW 11 8,387,251 (GRCm39) missense probably benign 0.00
R7443:Tns3 UTSW 11 8,401,442 (GRCm39) missense probably benign 0.01
R7459:Tns3 UTSW 11 8,442,793 (GRCm39) missense probably benign 0.16
R7474:Tns3 UTSW 11 8,480,894 (GRCm39) missense probably damaging 1.00
R7576:Tns3 UTSW 11 8,491,192 (GRCm39) missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8,442,701 (GRCm39) missense probably benign 0.01
R8055:Tns3 UTSW 11 8,495,343 (GRCm39) missense probably damaging 1.00
R8057:Tns3 UTSW 11 8,442,773 (GRCm39) missense probably benign
R8077:Tns3 UTSW 11 8,395,667 (GRCm39) missense probably damaging 1.00
R8518:Tns3 UTSW 11 8,442,971 (GRCm39) missense probably damaging 0.96
R8523:Tns3 UTSW 11 8,398,779 (GRCm39) missense probably damaging 1.00
R8790:Tns3 UTSW 11 8,468,273 (GRCm39) missense probably damaging 0.99
R9228:Tns3 UTSW 11 8,400,094 (GRCm39) missense probably damaging 1.00
R9374:Tns3 UTSW 11 8,442,606 (GRCm39) missense probably damaging 1.00
R9476:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9510:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9594:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9595:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9596:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9624:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9629:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
T0975:Tns3 UTSW 11 8,401,146 (GRCm39) missense probably benign 0.00
T0975:Tns3 UTSW 11 8,499,100 (GRCm39) start gained probably benign
T0975:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,401,224 (GRCm39) missense probably benign 0.00
Z1177:Tns3 UTSW 11 8,401,014 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTCTGGAAGGACATTCGG -3'
(R):5'- CCATGAGCTGTCCATGTCAGAG -3'

Sequencing Primer
(F):5'- ATGCTCATGGTGCTGCC -3'
(R):5'- TGTCCATGTCAGAGCCTCAG -3'
Posted On 2015-04-02