Mutagenetix > Incidental Mutation

Incidental Mutation 'R3765:Tns3'

274666

Institutional Source

Beutler Lab

Gene Symbol

Tns3

Ensembl Gene

ENSMUSG00000020422

Gene Name

tensin 3

Synonyms

TEM6, F830010I22Rik, Tens1

MMRRC Submission

040742-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.328) question?

Stock #

R3765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8431652-8664535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 8451133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1055 (A1055V)

Ref Sequence

ENSEMBL: ENSMUSP00000020695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020695]

AlphaFold

Q5SSZ5

Predicted Effect

probably benign
Transcript: ENSMUST00000020695
AA Change: A1055V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: A1055V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	1	171	5e-28	SMART
PTEN_C2	173	300	1.15e-48	SMART
low complexity region	854	864	N/A	INTRINSIC
low complexity region	1102	1126	N/A	INTRINSIC
SH2	1165	1268	1.32e-18	SMART
PTB	1301	1438	3.14e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129074

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap13	T	C	7: 75,608,837	V403A	probably benign	Het
Arid2	T	C	15: 96,370,714	S903P	probably benign	Het
Arl6ip6	T	A	2: 53,192,231	W37R	probably damaging	Het
Bag3	C	T	7: 128,540,271	T162I	probably benign	Het
C4b	G	A	17: 34,729,840	P1545S	probably damaging	Het
Ccdc185	T	A	1: 182,747,552	H524L	possibly damaging	Het
Cfap43	T	C	19: 47,835,575	N119S	probably benign	Het
Churc1	C	A	12: 76,773,283	S22*	probably null	Het
Crbn	T	C	6: 106,795,026	K106E	possibly damaging	Het
Dag1	C	T	9: 108,208,199	G581E	probably damaging	Het
Dpp4	T	A	2: 62,386,436	T92S	probably benign	Het
Fam135a	T	C	1: 24,055,877	T137A	possibly damaging	Het
Fermt1	T	C	2: 132,906,702	D667G	possibly damaging	Het
Foxl2	T	A	9: 98,955,986	I109N	probably damaging	Het
Frk	A	G	10: 34,484,005	M1V	probably null	Het
Fuk	A	G	8: 110,887,104	I775T	probably benign	Het
Gstm2	A	G	3: 107,984,030	F124S	probably damaging	Het
Hmcn1	T	C	1: 150,745,025	S1145G	possibly damaging	Het
Ints10	A	G	8: 68,825,119	T682A	possibly damaging	Het
Jmy	T	C	13: 93,464,711	M396V	possibly damaging	Het
Ldb3	A	T	14: 34,578,682		probably null	Het
Mre11a	A	G	9: 14,809,847	N354S	probably benign	Het
Nbea	A	G	3: 56,005,549	V939A	probably damaging	Het
Nphs1	T	C	7: 30,471,210	S928P	probably damaging	Het
Olfr1463	G	A	19: 13,234,431	M60I	probably damaging	Het
Olfr19	A	G	16: 16,673,315	V222A	probably benign	Het
Olfr311	T	C	11: 58,841,294	F60S	probably damaging	Het
Olfr954	T	A	9: 39,461,624	Y61*	probably null	Het
Pla2g12b	G	A	10: 59,421,501	V169M	probably damaging	Het
Polr1c	C	T	17: 46,247,924	V14M	probably damaging	Het
Prg4	G	A	1: 150,451,371	S898L	probably damaging	Het
Prmt6	C	A	3: 110,250,194	E260*	probably null	Het
Ptx4	A	G	17: 25,122,868	T106A	probably benign	Het
Rab3il1	A	G	19: 10,028,309	T87A	probably damaging	Het
Sbf2	A	G	7: 110,375,581	V783A	probably damaging	Het
Scn2a	A	C	2: 65,682,710	D209A	possibly damaging	Het
Setd2	T	C	9: 110,594,246	L345P	probably damaging	Het
Slc18b1	A	G	10: 23,798,749	D34G	probably damaging	Het
Slc9c1	A	T	16: 45,590,881	M934L	possibly damaging	Het
Slx4	A	G	16: 3,980,986	V1357A	probably damaging	Het
Spidr	T	C	16: 15,968,640	E413G	probably benign	Het
Taar1	A	G	10: 23,921,307	Y301C	probably damaging	Het
Tada2b	A	T	5: 36,476,417	D197E	probably benign	Het
Taf1c	G	T	8: 119,600,485	Y418*	probably null	Het
Tanc2	A	G	11: 105,914,970	D394G	probably damaging	Het
Tnpo3	T	C	6: 29,579,689	D235G	probably benign	Het
Wdfy3	A	G	5: 101,861,400	Y2767H	probably damaging	Het
Zfhx3	A	G	8: 108,792,762	N172S	probably damaging	Het
Zfp839	T	C	12: 110,855,163	V137A	probably benign	Het

Other mutations in Tns3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tns3	APN	11	8451066	missense	probably benign	0.42
IGL00822:Tns3	APN	11	8443976	missense	probably damaging	0.99
IGL01075:Tns3	APN	11	8478399	missense	probably benign	0.45
IGL01286:Tns3	APN	11	8492617	missense	probably benign	0.01
IGL01680:Tns3	APN	11	8548937	missense	probably damaging	1.00
IGL01687:Tns3	APN	11	8492798	missense	probably damaging	1.00
IGL01734:Tns3	APN	11	8519192	splice site	probably benign
IGL01844:Tns3	APN	11	8437177	missense	possibly damaging	0.58
IGL01984:Tns3	APN	11	8548992	nonsense	probably null
IGL02137:Tns3	APN	11	8492578	missense	possibly damaging	0.93
IGL02273:Tns3	APN	11	8434531	missense	probably damaging	1.00
IGL02623:Tns3	APN	11	8437141	missense	probably damaging	1.00
IGL02697:Tns3	APN	11	8492346	missense	probably benign	0.00
IGL02829:Tns3	APN	11	8519564	missense	probably damaging	1.00
ANU74:Tns3	UTSW	11	8492149	missense	probably benign	0.38
R0020:Tns3	UTSW	11	8545227	critical splice donor site	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0370:Tns3	UTSW	11	8445730	missense	possibly damaging	0.80
R0388:Tns3	UTSW	11	8445703	missense	probably benign	0.07
R0410:Tns3	UTSW	11	8435852	missense	probably benign	0.02
R0496:Tns3	UTSW	11	8547262	splice site	probably benign
R0562:Tns3	UTSW	11	8493262	missense	possibly damaging	0.93
R0626:Tns3	UTSW	11	8493121	missense	probably benign	0.04
R0736:Tns3	UTSW	11	8519474	missense	possibly damaging	0.94
R0893:Tns3	UTSW	11	8493302	missense	probably damaging	1.00
R1367:Tns3	UTSW	11	8448704	missense	probably benign	0.01
R1386:Tns3	UTSW	11	8518261	missense	probably benign	0.02
R1975:Tns3	UTSW	11	8435738	missense	probably benign	0.04
R2205:Tns3	UTSW	11	8531719	missense	probably damaging	1.00
R2319:Tns3	UTSW	11	8541200	missense	probably damaging	1.00
R2830:Tns3	UTSW	11	8435870	missense	probably damaging	1.00
R3720:Tns3	UTSW	11	8492999	missense	probably damaging	1.00
R3817:Tns3	UTSW	11	8434619	missense	probably damaging	1.00
R4058:Tns3	UTSW	11	8492275	missense	probably damaging	1.00
R4599:Tns3	UTSW	11	8531747	missense	probably damaging	1.00
R4631:Tns3	UTSW	11	8451119	missense	probably benign	0.30
R4731:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4732:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4733:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R5472:Tns3	UTSW	11	8451092	missense	probably benign
R5749:Tns3	UTSW	11	8451177	missense	probably benign	0.01
R5807:Tns3	UTSW	11	8493211	missense	probably damaging	1.00
R5844:Tns3	UTSW	11	8434580	missense	probably damaging	1.00
R5942:Tns3	UTSW	11	8435860	missense	probably damaging	1.00
R5982:Tns3	UTSW	11	8492245	missense	probably damaging	0.99
R6025:Tns3	UTSW	11	8492578	missense	possibly damaging	0.93
R6266:Tns3	UTSW	11	8492987	missense	probably damaging	1.00
R6322:Tns3	UTSW	11	8492147	missense	probably benign	0.01
R6536:Tns3	UTSW	11	8434531	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549057	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549058	missense	probably damaging	1.00
R6864:Tns3	UTSW	11	8493196	missense	probably damaging	1.00
R6897:Tns3	UTSW	11	8531743	missense	probably damaging	1.00
R7108:Tns3	UTSW	11	8437251	missense	probably benign	0.00
R7443:Tns3	UTSW	11	8451442	missense	probably benign	0.01
R7459:Tns3	UTSW	11	8492793	missense	probably benign	0.16
R7474:Tns3	UTSW	11	8530894	missense	probably damaging	1.00
R7576:Tns3	UTSW	11	8541192	missense	possibly damaging	0.78
R7979:Tns3	UTSW	11	8492701	missense	probably benign	0.01
R8055:Tns3	UTSW	11	8545343	missense	probably damaging	1.00
R8057:Tns3	UTSW	11	8492773	missense	probably benign
R8077:Tns3	UTSW	11	8445667	missense	probably damaging	1.00
R8518:Tns3	UTSW	11	8492971	missense	probably damaging	0.96
R8523:Tns3	UTSW	11	8448779	missense	probably damaging	1.00
R8790:Tns3	UTSW	11	8518273	missense	probably damaging	0.99
R9228:Tns3	UTSW	11	8450094	missense	probably damaging	1.00
R9374:Tns3	UTSW	11	8492606	missense	probably damaging	1.00
R9476:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9510:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9594:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9595:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9596:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9624:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9629:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
T0975:Tns3	UTSW	11	8451146	missense	probably benign	0.00
T0975:Tns3	UTSW	11	8479518	missense	probably benign
T0975:Tns3	UTSW	11	8549100	start gained	probably benign
X0005:Tns3	UTSW	11	8451224	missense	probably benign	0.00
X0005:Tns3	UTSW	11	8479518	missense	probably benign
Z1177:Tns3	UTSW	11	8451014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAGTCTGGAAGGACATTCGG -3'
(R):5'- CCATGAGCTGTCCATGTCAGAG -3'

Sequencing Primer
(F):5'- ATGCTCATGGTGCTGCC -3'
(R):5'- TGTCCATGTCAGAGCCTCAG -3'

Posted On

2015-04-02