Incidental Mutation 'R3765:Olfr311'
ID274667
Institutional Source Beutler Lab
Gene Symbol Olfr311
Ensembl Gene ENSMUSG00000094805
Gene Nameolfactory receptor 311
SynonymsMOR222-1, GA_x6K02T2NKPP-565870-564944
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58839251-58844111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58841294 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 60 (F60S)
Ref Sequence ENSEMBL: ENSMUSP00000150870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071625] [ENSMUST00000216473]
Predicted Effect probably damaging
Transcript: ENSMUST00000071625
AA Change: F60S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071553
Gene: ENSMUSG00000094805
AA Change: F60S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 9e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 215 1.7e-8 PFAM
Pfam:7tm_1 39 288 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214776
Predicted Effect probably damaging
Transcript: ENSMUST00000216473
AA Change: F60S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Olfr311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Olfr311 APN 11 58841512 missense probably benign 0.10
H8786:Olfr311 UTSW 11 58841320 missense probably benign 0.22
R0620:Olfr311 UTSW 11 58841443 missense probably damaging 1.00
R0671:Olfr311 UTSW 11 58841855 missense possibly damaging 0.94
R0827:Olfr311 UTSW 11 58841771 missense probably damaging 1.00
R0839:Olfr311 UTSW 11 58841652 missense probably benign
R0932:Olfr311 UTSW 11 58841714 missense possibly damaging 0.92
R1117:Olfr311 UTSW 11 58841815 missense possibly damaging 0.64
R1533:Olfr311 UTSW 11 58841966 missense probably damaging 1.00
R1540:Olfr311 UTSW 11 58841651 missense probably benign 0.01
R1595:Olfr311 UTSW 11 58841652 missense probably benign
R1826:Olfr311 UTSW 11 58841431 missense probably benign
R2857:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2858:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2859:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R3438:Olfr311 UTSW 11 58841872 nonsense probably null
R3831:Olfr311 UTSW 11 58841860 missense probably damaging 0.99
R4858:Olfr311 UTSW 11 58841207 missense possibly damaging 0.86
R5651:Olfr311 UTSW 11 58841491 nonsense probably null
R5979:Olfr311 UTSW 11 58841840 missense probably damaging 1.00
R6316:Olfr311 UTSW 11 58841942 missense probably damaging 1.00
R6717:Olfr311 UTSW 11 58841287 missense probably damaging 1.00
R7163:Olfr311 UTSW 11 58841186 missense probably benign 0.12
R7605:Olfr311 UTSW 11 58841500 missense probably benign 0.00
R8328:Olfr311 UTSW 11 58841634 missense probably benign 0.00
Z1186:Olfr311 UTSW 11 58841081 start gained probably benign
Z1186:Olfr311 UTSW 11 58841119 missense probably benign
Z1186:Olfr311 UTSW 11 58841206 missense probably benign
Z1186:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1186:Olfr311 UTSW 11 58841789 missense probably benign
Z1187:Olfr311 UTSW 11 58841081 start gained probably benign
Z1187:Olfr311 UTSW 11 58841119 missense probably benign
Z1187:Olfr311 UTSW 11 58841206 missense probably benign
Z1187:Olfr311 UTSW 11 58841258 missense probably benign
Z1187:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1187:Olfr311 UTSW 11 58841789 missense probably benign
Z1188:Olfr311 UTSW 11 58841081 start gained probably benign
Z1188:Olfr311 UTSW 11 58841119 missense probably benign
Z1188:Olfr311 UTSW 11 58841206 missense probably benign
Z1188:Olfr311 UTSW 11 58841258 missense probably benign
Z1188:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1188:Olfr311 UTSW 11 58841789 missense probably benign
Z1189:Olfr311 UTSW 11 58841081 start gained probably benign
Z1189:Olfr311 UTSW 11 58841119 missense probably benign
Z1189:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1189:Olfr311 UTSW 11 58841789 missense probably benign
Z1190:Olfr311 UTSW 11 58841081 start gained probably benign
Z1190:Olfr311 UTSW 11 58841119 missense probably benign
Z1190:Olfr311 UTSW 11 58841206 missense probably benign
Z1190:Olfr311 UTSW 11 58841258 missense probably benign
Z1190:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1190:Olfr311 UTSW 11 58841789 missense probably benign
Z1191:Olfr311 UTSW 11 58841081 start gained probably benign
Z1191:Olfr311 UTSW 11 58841119 missense probably benign
Z1191:Olfr311 UTSW 11 58841206 missense probably benign
Z1191:Olfr311 UTSW 11 58841258 missense probably benign
Z1191:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1191:Olfr311 UTSW 11 58841789 missense probably benign
Z1192:Olfr311 UTSW 11 58841081 start gained probably benign
Z1192:Olfr311 UTSW 11 58841119 missense probably benign
Z1192:Olfr311 UTSW 11 58841206 missense probably benign
Z1192:Olfr311 UTSW 11 58841743 missense probably benign 0.16
Z1192:Olfr311 UTSW 11 58841789 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCAGACATGGCCAATCAC -3'
(R):5'- GATGGTTCCATAGATCAGTGGTC -3'

Sequencing Primer
(F):5'- GACATGGCCAATCACACAAGAG -3'
(R):5'- ACCGGTCATAAGCCATGGC -3'
Posted On2015-04-02