Mutagenetix > Incidental Mutation

Incidental Mutation 'R3765:Tanc2'

274669

Institutional Source

Beutler Lab

Gene Symbol

Tanc2

Ensembl Gene

ENSMUSG00000053580

Gene Name

tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2

Synonyms

5730590C14Rik, 3526402J09Rik

MMRRC Submission

040742-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105589986-105929304 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105914970 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 394 (D394G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100330]

AlphaFold

A2A690

Predicted Effect

probably damaging
Transcript: ENSMUST00000089485
AA Change: D296G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000086912
Gene: ENSMUSG00000053580
AA Change: D296G

Domain	Start	End	E-Value	Type
ANK	35	63	1.16e3	SMART
ANK	78	107	3.31e-1	SMART
ANK	111	140	7.71e-2	SMART
ANK	144	173	6.12e-5	SMART
ANK	177	206	8.99e-3	SMART
ANK	210	239	5.71e-5	SMART
ANK	243	272	2.11e2	SMART
Blast:TPR	289	322	3e-14	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100330
AA Change: D1252G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: D1252G

Domain	Start	End	E-Value	Type
low complexity region	32	50	N/A	INTRINSIC
low complexity region	129	152	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	436	447	N/A	INTRINSIC
low complexity region	823	834	N/A	INTRINSIC
ANK	846	878	2.08e3	SMART
ANK	882	913	2.97e2	SMART
ANK	917	946	5.75e-1	SMART
ANK	950	979	8.62e1	SMART
ANK	990	1018	1.16e3	SMART
ANK	1033	1062	3.31e-1	SMART
ANK	1066	1095	7.71e-2	SMART
ANK	1099	1128	6.12e-5	SMART
ANK	1132	1161	8.99e-3	SMART
ANK	1165	1194	5.71e-5	SMART
ANK	1198	1227	2.11e2	SMART
TPR	1244	1277	3.89e1	SMART
TPR	1291	1324	3.61e-2	SMART
TPR	1325	1358	2.82e-4	SMART
low complexity region	1369	1406	N/A	INTRINSIC
low complexity region	1533	1539	N/A	INTRINSIC
low complexity region	1787	1802	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000146162
AA Change: D394G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123674
Gene: ENSMUSG00000053580
AA Change: D394G

Domain	Start	End	E-Value	Type
ANK	15	46	2.97e2	SMART
ANK	50	79	5.75e-1	SMART
ANK	83	112	8.62e1	SMART
ANK	123	151	1.16e3	SMART
ANK	166	195	3.31e-1	SMART
ANK	199	228	7.71e-2	SMART
ANK	232	261	6.12e-5	SMART
ANK	265	294	8.99e-3	SMART
ANK	298	327	5.71e-5	SMART
ANK	331	360	3.44e1	SMART
TPR	387	420	3.89e1	SMART
TPR	434	467	3.61e-2	SMART
TPR	468	501	2.82e-4	SMART
low complexity region	512	549	N/A	INTRINSIC
low complexity region	676	682	N/A	INTRINSIC
low complexity region	930	945	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147975

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap13	T	C	7: 75,608,837	V403A	probably benign	Het
Arid2	T	C	15: 96,370,714	S903P	probably benign	Het
Arl6ip6	T	A	2: 53,192,231	W37R	probably damaging	Het
Bag3	C	T	7: 128,540,271	T162I	probably benign	Het
C4b	G	A	17: 34,729,840	P1545S	probably damaging	Het
Ccdc185	T	A	1: 182,747,552	H524L	possibly damaging	Het
Cfap43	T	C	19: 47,835,575	N119S	probably benign	Het
Churc1	C	A	12: 76,773,283	S22*	probably null	Het
Crbn	T	C	6: 106,795,026	K106E	possibly damaging	Het
Dag1	C	T	9: 108,208,199	G581E	probably damaging	Het
Dpp4	T	A	2: 62,386,436	T92S	probably benign	Het
Fam135a	T	C	1: 24,055,877	T137A	possibly damaging	Het
Fermt1	T	C	2: 132,906,702	D667G	possibly damaging	Het
Foxl2	T	A	9: 98,955,986	I109N	probably damaging	Het
Frk	A	G	10: 34,484,005	M1V	probably null	Het
Fuk	A	G	8: 110,887,104	I775T	probably benign	Het
Gstm2	A	G	3: 107,984,030	F124S	probably damaging	Het
Hmcn1	T	C	1: 150,745,025	S1145G	possibly damaging	Het
Ints10	A	G	8: 68,825,119	T682A	possibly damaging	Het
Jmy	T	C	13: 93,464,711	M396V	possibly damaging	Het
Ldb3	A	T	14: 34,578,682		probably null	Het
Mre11a	A	G	9: 14,809,847	N354S	probably benign	Het
Nbea	A	G	3: 56,005,549	V939A	probably damaging	Het
Nphs1	T	C	7: 30,471,210	S928P	probably damaging	Het
Olfr1463	G	A	19: 13,234,431	M60I	probably damaging	Het
Olfr19	A	G	16: 16,673,315	V222A	probably benign	Het
Olfr311	T	C	11: 58,841,294	F60S	probably damaging	Het
Olfr954	T	A	9: 39,461,624	Y61*	probably null	Het
Pla2g12b	G	A	10: 59,421,501	V169M	probably damaging	Het
Polr1c	C	T	17: 46,247,924	V14M	probably damaging	Het
Prg4	G	A	1: 150,451,371	S898L	probably damaging	Het
Prmt6	C	A	3: 110,250,194	E260*	probably null	Het
Ptx4	A	G	17: 25,122,868	T106A	probably benign	Het
Rab3il1	A	G	19: 10,028,309	T87A	probably damaging	Het
Sbf2	A	G	7: 110,375,581	V783A	probably damaging	Het
Scn2a	A	C	2: 65,682,710	D209A	possibly damaging	Het
Setd2	T	C	9: 110,594,246	L345P	probably damaging	Het
Slc18b1	A	G	10: 23,798,749	D34G	probably damaging	Het
Slc9c1	A	T	16: 45,590,881	M934L	possibly damaging	Het
Slx4	A	G	16: 3,980,986	V1357A	probably damaging	Het
Spidr	T	C	16: 15,968,640	E413G	probably benign	Het
Taar1	A	G	10: 23,921,307	Y301C	probably damaging	Het
Tada2b	A	T	5: 36,476,417	D197E	probably benign	Het
Taf1c	G	T	8: 119,600,485	Y418*	probably null	Het
Tnpo3	T	C	6: 29,579,689	D235G	probably benign	Het
Tns3	G	A	11: 8,451,133	A1055V	probably benign	Het
Wdfy3	A	G	5: 101,861,400	Y2767H	probably damaging	Het
Zfhx3	A	G	8: 108,792,762	N172S	probably damaging	Het
Zfp839	T	C	12: 110,855,163	V137A	probably benign	Het

Other mutations in Tanc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Tanc2	APN	11	105923220	missense	probably benign	0.28
IGL00688:Tanc2	APN	11	105798690	missense	probably damaging	1.00
IGL00709:Tanc2	APN	11	105798795	missense	probably damaging	1.00
IGL01013:Tanc2	APN	11	105625065	missense	probably damaging	0.96
IGL01141:Tanc2	APN	11	105886474	splice site	probably benign
IGL01386:Tanc2	APN	11	105886381	missense	probably damaging	0.99
IGL01433:Tanc2	APN	11	105810522	missense	possibly damaging	0.75
IGL01562:Tanc2	APN	11	105780069	missense	probably benign	0.00
IGL01979:Tanc2	APN	11	105776920	missense	probably benign
IGL02104:Tanc2	APN	11	105780133	unclassified	probably benign
IGL02434:Tanc2	APN	11	105780042	missense	probably benign	0.14
IGL02534:Tanc2	APN	11	105835168	missense	probably damaging	1.00
IGL02568:Tanc2	APN	11	105776951	missense	probably benign	0.00
IGL03279:Tanc2	APN	11	105913092	splice site	probably null
R0595:Tanc2	UTSW	11	105714177	splice site	probably null
R1131:Tanc2	UTSW	11	105835002	missense	probably damaging	1.00
R1320:Tanc2	UTSW	11	105886444	missense	probably damaging	1.00
R1487:Tanc2	UTSW	11	105923634	missense	probably damaging	0.99
R1497:Tanc2	UTSW	11	105922137	missense	probably benign	0.21
R1692:Tanc2	UTSW	11	105857500	missense	probably benign
R1712:Tanc2	UTSW	11	105899780	missense	probably benign
R1793:Tanc2	UTSW	11	105625033	critical splice acceptor site	probably null
R1812:Tanc2	UTSW	11	105886386	missense	probably benign	0.01
R1905:Tanc2	UTSW	11	105922863	missense	possibly damaging	0.61
R1959:Tanc2	UTSW	11	105910295	missense	probably damaging	1.00
R1962:Tanc2	UTSW	11	105798732	missense	probably benign	0.14
R2122:Tanc2	UTSW	11	105895949	missense	probably damaging	1.00
R2174:Tanc2	UTSW	11	105910309	missense	probably benign	0.00
R2341:Tanc2	UTSW	11	105835051	missense	probably benign	0.09
R2497:Tanc2	UTSW	11	105673493	critical splice donor site	probably null
R3438:Tanc2	UTSW	11	105857575	missense	probably damaging	0.97
R3711:Tanc2	UTSW	11	105798690	missense	probably damaging	1.00
R3890:Tanc2	UTSW	11	105798678	missense	probably damaging	1.00
R4193:Tanc2	UTSW	11	105914062	intron	probably benign
R4609:Tanc2	UTSW	11	105910240	missense	probably benign	0.24
R4674:Tanc2	UTSW	11	105867480	missense	probably damaging	1.00
R4928:Tanc2	UTSW	11	105867762	missense	probably damaging	1.00
R5008:Tanc2	UTSW	11	105625060	start codon destroyed	probably null	0.46
R5010:Tanc2	UTSW	11	105780092	missense	probably damaging	1.00
R5135:Tanc2	UTSW	11	105857553	missense	possibly damaging	0.93
R5385:Tanc2	UTSW	11	105776846	missense	probably damaging	0.99
R5409:Tanc2	UTSW	11	105867485	missense	possibly damaging	0.93
R5419:Tanc2	UTSW	11	105922883	missense	probably benign	0.00
R5501:Tanc2	UTSW	11	105914985	critical splice donor site	probably null
R5590:Tanc2	UTSW	11	105923306	missense	probably damaging	0.99
R5651:Tanc2	UTSW	11	105798700	missense	probably benign	0.44
R5798:Tanc2	UTSW	11	105921855	small deletion	probably benign
R5876:Tanc2	UTSW	11	105922613	missense	possibly damaging	0.71
R5889:Tanc2	UTSW	11	105921807	missense	probably benign	0.23
R5958:Tanc2	UTSW	11	105840625	missense	probably benign	0.00
R5999:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6024:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6024:Tanc2	UTSW	11	105923672	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6025:Tanc2	UTSW	11	105896547	missense	possibly damaging	0.68
R6048:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6049:Tanc2	UTSW	11	105867717	missense	probably damaging	1.00
R6185:Tanc2	UTSW	11	105913039	missense	probably damaging	1.00
R6335:Tanc2	UTSW	11	105857556	missense	probably damaging	0.99
R6821:Tanc2	UTSW	11	105886490	splice site	probably null
R6846:Tanc2	UTSW	11	105798653	missense	probably benign	0.34
R6857:Tanc2	UTSW	11	105910288	missense	possibly damaging	0.81
R6904:Tanc2	UTSW	11	105835230	missense	possibly damaging	0.89
R7009:Tanc2	UTSW	11	105840699	missense	possibly damaging	0.47
R7017:Tanc2	UTSW	11	105923108	missense	probably benign
R7371:Tanc2	UTSW	11	105798596	missense	probably benign
R7556:Tanc2	UTSW	11	105909031	missense
R7630:Tanc2	UTSW	11	105776908	missense	probably benign	0.04
R7693:Tanc2	UTSW	11	105923467	missense	probably damaging	1.00
R7757:Tanc2	UTSW	11	105776858	missense	possibly damaging	0.81
R7807:Tanc2	UTSW	11	105867654	missense	probably benign	0.00
R7878:Tanc2	UTSW	11	105913415	missense
R7895:Tanc2	UTSW	11	105921825	missense	probably damaging	1.00
R7952:Tanc2	UTSW	11	105896597	missense	probably damaging	1.00
R8099:Tanc2	UTSW	11	105864007	missense	probably benign	0.17
R8117:Tanc2	UTSW	11	105835162	missense	probably damaging	1.00
R8133:Tanc2	UTSW	11	105923222	missense	probably damaging	0.97
R8422:Tanc2	UTSW	11	105835188	missense	probably benign	0.10
R8527:Tanc2	UTSW	11	105917008	missense	probably damaging	0.96
R8542:Tanc2	UTSW	11	105917008	missense	probably damaging	0.96
R8834:Tanc2	UTSW	11	105917019	missense
R8912:Tanc2	UTSW	11	105867327	missense	probably benign	0.01
R8927:Tanc2	UTSW	11	105810505	missense	probably damaging	0.99
R8928:Tanc2	UTSW	11	105810505	missense	probably damaging	0.99
R8968:Tanc2	UTSW	11	105867574	missense	possibly damaging	0.50
R9065:Tanc2	UTSW	11	105798692	nonsense	probably null
R9095:Tanc2	UTSW	11	105867278	missense	probably benign	0.00
R9108:Tanc2	UTSW	11	105919754	intron	probably benign
R9131:Tanc2	UTSW	11	105798777	missense	probably benign
R9294:Tanc2	UTSW	11	105886458	missense	probably damaging	0.99
R9445:Tanc2	UTSW	11	105867464	missense	possibly damaging	0.80
X0027:Tanc2	UTSW	11	105835183	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- CTCCCAGGTCTAGAAGATGAGG -3'
(R):5'- CCAGAATGTTTTGCTCTTTTACCAG -3'

Sequencing Primer
(F):5'- GGACAAGTTGTTCTCTCAGCAG -3'
(R):5'- GTTTTGCTCTTTTACCAGGAAAGC -3'

Posted On

2015-04-02