Incidental Mutation 'R3765:Churc1'
ID274670
Institutional Source Beutler Lab
Gene Symbol Churc1
Ensembl Gene ENSMUSG00000090258
Gene Namechurchill domain containing 1
Synonymschch, My015, 1700030P15Rik
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76765538-76783180 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 76773283 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 22 (S22*)
Ref Sequence ENSEMBL: ENSMUSP00000120713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041262] [ENSMUST00000110399] [ENSMUST00000125842] [ENSMUST00000126408] [ENSMUST00000137826]
Predicted Effect probably null
Transcript: ENSMUST00000041262
AA Change: S22*
SMART Domains Protein: ENSMUSP00000047015
Gene: ENSMUSG00000090258
AA Change: S22*

DomainStartEndE-ValueType
Pfam:Churchill 1 112 2.6e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110399
AA Change: S22*
SMART Domains Protein: ENSMUSP00000106029
Gene: ENSMUSG00000090258
AA Change: S22*

DomainStartEndE-ValueType
Pfam:Churchill 1 69 2.8e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125842
AA Change: S22*
SMART Domains Protein: ENSMUSP00000116906
Gene: ENSMUSG00000033373
AA Change: S22*

DomainStartEndE-ValueType
Pfam:Churchill 1 65 2.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126408
Predicted Effect probably null
Transcript: ENSMUST00000137826
AA Change: S22*
SMART Domains Protein: ENSMUSP00000120713
Gene: ENSMUSG00000033373
AA Change: S22*

DomainStartEndE-ValueType
Pfam:Churchill 1 92 1.9e-42 PFAM
Pfam:Prenyltrans 157 198 5.1e-16 PFAM
Pfam:Prenyltrans 206 249 2.8e-13 PFAM
Pfam:Prenyltrans 255 297 1e-14 PFAM
Pfam:Prenyltrans 302 346 1.6e-12 PFAM
Pfam:Prenyltrans 364 408 1.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152917
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Churc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Winston UTSW 12 76775631 missense probably damaging 0.98
R1835:Churc1 UTSW 12 76773297 missense possibly damaging 0.70
R4809:Churc1 UTSW 12 76782897 missense probably damaging 1.00
R6750:Churc1 UTSW 12 76775631 missense probably damaging 0.98
R7728:Churc1 UTSW 12 76773278 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTTCACATGTGCATCAAGTGTCC -3'
(R):5'- ACTGAACGTGCCCTCAGAAC -3'

Sequencing Primer
(F):5'- CATGTGCATCAAGTGTCCTTATAAG -3'
(R):5'- GTGCCCTCAGAACACCCATAC -3'
Posted On2015-04-02