Incidental Mutation 'R3765:Ldb3'
ID274674
Institutional Source Beutler Lab
Gene Symbol Ldb3
Ensembl Gene ENSMUSG00000021798
Gene NameLIM domain binding 3
Synonymscypher, ZASP
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34526603-34588682 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 34578682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022327] [ENSMUST00000022327] [ENSMUST00000022327] [ENSMUST00000022328] [ENSMUST00000022328] [ENSMUST00000022328] [ENSMUST00000022330] [ENSMUST00000022330] [ENSMUST00000022330] [ENSMUST00000064098] [ENSMUST00000064098] [ENSMUST00000064098] [ENSMUST00000090040] [ENSMUST00000090040] [ENSMUST00000090040] [ENSMUST00000227819] [ENSMUST00000227819] [ENSMUST00000227819] [ENSMUST00000228044] [ENSMUST00000228044] [ENSMUST00000228044]
Predicted Effect probably null
Transcript: ENSMUST00000022327
SMART Domains Protein: ENSMUSP00000022327
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
low complexity region 359 376 N/A INTRINSIC
low complexity region 418 473 N/A INTRINSIC
LIM 546 597 2.72e-16 SMART
LIM 605 656 2.65e-19 SMART
LIM 664 717 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022327
SMART Domains Protein: ENSMUSP00000022327
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
low complexity region 359 376 N/A INTRINSIC
low complexity region 418 473 N/A INTRINSIC
LIM 546 597 2.72e-16 SMART
LIM 605 656 2.65e-19 SMART
LIM 664 717 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022327
SMART Domains Protein: ENSMUSP00000022327
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 309 353 N/A INTRINSIC
low complexity region 359 376 N/A INTRINSIC
low complexity region 418 473 N/A INTRINSIC
LIM 546 597 2.72e-16 SMART
LIM 605 656 2.65e-19 SMART
LIM 664 717 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022328
SMART Domains Protein: ENSMUSP00000022328
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
low complexity region 356 411 N/A INTRINSIC
LIM 484 535 2.72e-16 SMART
LIM 543 594 2.65e-19 SMART
LIM 602 655 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022328
SMART Domains Protein: ENSMUSP00000022328
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
low complexity region 356 411 N/A INTRINSIC
LIM 484 535 2.72e-16 SMART
LIM 543 594 2.65e-19 SMART
LIM 602 655 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022328
SMART Domains Protein: ENSMUSP00000022328
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
low complexity region 356 411 N/A INTRINSIC
LIM 484 535 2.72e-16 SMART
LIM 543 594 2.65e-19 SMART
LIM 602 655 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000022330
SMART Domains Protein: ENSMUSP00000022330
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000022330
SMART Domains Protein: ENSMUSP00000022330
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000022330
SMART Domains Protein: ENSMUSP00000022330
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
low complexity region 138 147 N/A INTRINSIC
ZM 186 211 1.33e-8 SMART
low complexity region 214 229 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000064098
SMART Domains Protein: ENSMUSP00000066784
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 265 309 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 374 429 N/A INTRINSIC
LIM 502 553 2.72e-16 SMART
LIM 561 612 2.65e-19 SMART
LIM 620 673 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000064098
SMART Domains Protein: ENSMUSP00000066784
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 265 309 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 374 429 N/A INTRINSIC
LIM 502 553 2.72e-16 SMART
LIM 561 612 2.65e-19 SMART
LIM 620 673 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000064098
SMART Domains Protein: ENSMUSP00000066784
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 265 309 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 374 429 N/A INTRINSIC
LIM 502 553 2.72e-16 SMART
LIM 561 612 2.65e-19 SMART
LIM 620 673 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000090040
SMART Domains Protein: ENSMUSP00000087494
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 270 314 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 379 434 N/A INTRINSIC
LIM 507 558 2.72e-16 SMART
LIM 566 617 2.65e-19 SMART
LIM 625 678 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000090040
SMART Domains Protein: ENSMUSP00000087494
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 270 314 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 379 434 N/A INTRINSIC
LIM 507 558 2.72e-16 SMART
LIM 566 617 2.65e-19 SMART
LIM 625 678 1.04e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000090040
SMART Domains Protein: ENSMUSP00000087494
Gene: ENSMUSG00000021798

DomainStartEndE-ValueType
PDZ 11 84 1.68e-16 SMART
ZM 148 173 5.18e-11 SMART
low complexity region 270 314 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 379 434 N/A INTRINSIC
LIM 507 558 2.72e-16 SMART
LIM 566 617 2.65e-19 SMART
LIM 625 678 1.04e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226226
Predicted Effect probably null
Transcript: ENSMUST00000227819
Predicted Effect probably null
Transcript: ENSMUST00000227819
Predicted Effect probably null
Transcript: ENSMUST00000227819
Predicted Effect probably null
Transcript: ENSMUST00000228044
Predicted Effect probably null
Transcript: ENSMUST00000228044
Predicted Effect probably null
Transcript: ENSMUST00000228044
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in lethality within a few days after birth from muscle abnormalities. Mutant mice exhibit myopathy, dysphagia, heart vascular congestion, dilated heart ventricles, cyanosis, and respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Ldb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ldb3 APN 14 34544200 missense probably damaging 0.99
IGL01485:Ldb3 APN 14 34542562 missense probably damaging 1.00
IGL01983:Ldb3 APN 14 34577199 missense probably benign 0.00
R0323:Ldb3 UTSW 14 34544045 missense probably damaging 1.00
R0335:Ldb3 UTSW 14 34578651 missense possibly damaging 0.77
R0483:Ldb3 UTSW 14 34536584 missense probably damaging 1.00
R0920:Ldb3 UTSW 14 34567503 missense probably benign 0.05
R1524:Ldb3 UTSW 14 34555356 missense probably benign 0.01
R2161:Ldb3 UTSW 14 34567396 critical splice donor site probably null
R2246:Ldb3 UTSW 14 34529475 missense probably damaging 0.99
R2865:Ldb3 UTSW 14 34529503 missense probably damaging 1.00
R3113:Ldb3 UTSW 14 34529461 makesense probably null
R3870:Ldb3 UTSW 14 34567483 missense probably damaging 1.00
R4018:Ldb3 UTSW 14 34552171 splice site probably benign
R4797:Ldb3 UTSW 14 34555513 missense possibly damaging 0.95
R4963:Ldb3 UTSW 14 34566858 missense probably damaging 0.98
R5705:Ldb3 UTSW 14 34577029 missense probably null 0.01
R6401:Ldb3 UTSW 14 34577334 missense probably benign 0.33
R6549:Ldb3 UTSW 14 34541897 missense probably damaging 0.99
R6682:Ldb3 UTSW 14 34552264 missense possibly damaging 0.77
R6917:Ldb3 UTSW 14 34555364 missense probably null 0.03
R7132:Ldb3 UTSW 14 34577035 missense probably benign 0.25
R7327:Ldb3 UTSW 14 34571802 missense probably damaging 1.00
R7488:Ldb3 UTSW 14 34567445 missense probably damaging 1.00
R7760:Ldb3 UTSW 14 34542503 missense probably damaging 1.00
R8755:Ldb3 UTSW 14 34577299 missense probably damaging 1.00
R8845:Ldb3 UTSW 14 34536677 missense probably damaging 1.00
R8954:Ldb3 UTSW 14 34555344 missense probably null 0.17
Z1176:Ldb3 UTSW 14 34555365 missense probably benign 0.21
Z1177:Ldb3 UTSW 14 34544103 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTCAAACACTTTCCATGAGG -3'
(R):5'- TGTAGAAGAAGCCTGTGAATGC -3'

Sequencing Primer
(F):5'- GGACAGGCAGGCAAGATTTTG -3'
(R):5'- CCTGTGAATGCTGAAGGAAAC -3'
Posted On2015-04-02