Incidental Mutation 'R3765:Slx4'
ID 274676
Institutional Source Beutler Lab
Gene Symbol Slx4
Ensembl Gene ENSMUSG00000039738
Gene Name SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms D16Bwg1016e, Btbd12
MMRRC Submission 040742-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 3796969-3821634 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3798850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1357 (V1357A)
Ref Sequence ENSEMBL: ENSMUSP00000038871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040790] [ENSMUST00000177551] [ENSMUST00000180200]
AlphaFold Q6P1D7
Predicted Effect probably damaging
Transcript: ENSMUST00000040790
AA Change: V1357A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: V1357A

DomainStartEndE-ValueType
low complexity region 400 413 N/A INTRINSIC
BTB 506 609 6.15e-7 SMART
low complexity region 651 667 N/A INTRINSIC
low complexity region 833 849 N/A INTRINSIC
low complexity region 857 875 N/A INTRINSIC
low complexity region 1176 1192 N/A INTRINSIC
low complexity region 1437 1461 N/A INTRINSIC
Pfam:Slx4 1484 1541 3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145706
Predicted Effect probably benign
Transcript: ENSMUST00000146569
SMART Domains Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738

DomainStartEndE-ValueType
Pfam:BTB 6 102 6.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156542
Predicted Effect probably benign
Transcript: ENSMUST00000177551
SMART Domains Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
Pfam:NACHT 176 342 2e-34 PFAM
LRR 702 729 3.11e-2 SMART
LRR 730 757 2.27e-4 SMART
LRR 758 785 8.15e-1 SMART
LRR 786 813 2.17e-1 SMART
LRR 814 841 2.12e-4 SMART
LRR 842 869 3.42e0 SMART
LRR 870 897 7.67e-2 SMART
LRR 898 925 3.21e0 SMART
LRR 926 953 1.67e0 SMART
LRR 954 981 4.87e-4 SMART
LRR 982 1009 4.3e0 SMART
LRR 1010 1037 3.8e-6 SMART
LRR 1038 1065 4.47e-3 SMART
LRR 1066 1093 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180200
SMART Domains Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
LRR 4 24 8.65e1 SMART
LRR 25 52 2.27e-4 SMART
LRR 53 80 8.15e-1 SMART
LRR 81 108 2.17e-1 SMART
LRR 109 136 2.12e-4 SMART
LRR 137 164 3.42e0 SMART
LRR 165 192 7.67e-2 SMART
LRR 193 220 3.21e0 SMART
LRR 221 248 1.67e0 SMART
LRR 249 276 4.87e-4 SMART
LRR 277 304 4.3e0 SMART
LRR 305 332 3.8e-6 SMART
LRR 333 360 4.47e-3 SMART
LRR 361 388 1.08e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,258,585 (GRCm39) V403A probably benign Het
Arid2 T C 15: 96,268,595 (GRCm39) S903P probably benign Het
Arl6ip6 T A 2: 53,082,243 (GRCm39) W37R probably damaging Het
Bag3 C T 7: 128,141,995 (GRCm39) T162I probably benign Het
C4b G A 17: 34,948,814 (GRCm39) P1545S probably damaging Het
Ccdc185 T A 1: 182,575,117 (GRCm39) H524L possibly damaging Het
Cfap43 T C 19: 47,824,014 (GRCm39) N119S probably benign Het
Churc1 C A 12: 76,820,057 (GRCm39) S22* probably null Het
Crbn T C 6: 106,771,987 (GRCm39) K106E possibly damaging Het
Dag1 C T 9: 108,085,398 (GRCm39) G581E probably damaging Het
Dpp4 T A 2: 62,216,780 (GRCm39) T92S probably benign Het
Fam135a T C 1: 24,094,958 (GRCm39) T137A possibly damaging Het
Fcsk A G 8: 111,613,736 (GRCm39) I775T probably benign Het
Fermt1 T C 2: 132,748,622 (GRCm39) D667G possibly damaging Het
Foxl2 T A 9: 98,838,039 (GRCm39) I109N probably damaging Het
Frk A G 10: 34,360,001 (GRCm39) M1V probably null Het
Gstm2 A G 3: 107,891,346 (GRCm39) F124S probably damaging Het
Hmcn1 T C 1: 150,620,776 (GRCm39) S1145G possibly damaging Het
Ints10 A G 8: 69,277,771 (GRCm39) T682A possibly damaging Het
Jmy T C 13: 93,601,219 (GRCm39) M396V possibly damaging Het
Ldb3 A T 14: 34,300,639 (GRCm39) probably null Het
Mre11a A G 9: 14,721,143 (GRCm39) N354S probably benign Het
Nbea A G 3: 55,912,970 (GRCm39) V939A probably damaging Het
Nphs1 T C 7: 30,170,635 (GRCm39) S928P probably damaging Het
Or5b109 G A 19: 13,211,795 (GRCm39) M60I probably damaging Het
Or7a40 A G 16: 16,491,179 (GRCm39) V222A probably benign Het
Or8g34 T A 9: 39,372,920 (GRCm39) Y61* probably null Het
Or9e1 T C 11: 58,732,120 (GRCm39) F60S probably damaging Het
Pla2g12b G A 10: 59,257,323 (GRCm39) V169M probably damaging Het
Polr1c C T 17: 46,558,850 (GRCm39) V14M probably damaging Het
Prg4 G A 1: 150,327,122 (GRCm39) S898L probably damaging Het
Prmt6 C A 3: 110,157,510 (GRCm39) E260* probably null Het
Ptx4 A G 17: 25,341,842 (GRCm39) T106A probably benign Het
Rab3il1 A G 19: 10,005,673 (GRCm39) T87A probably damaging Het
Sbf2 A G 7: 109,974,788 (GRCm39) V783A probably damaging Het
Scn2a A C 2: 65,513,054 (GRCm39) D209A possibly damaging Het
Setd2 T C 9: 110,423,314 (GRCm39) L345P probably damaging Het
Slc18b1 A G 10: 23,674,647 (GRCm39) D34G probably damaging Het
Slc9c1 A T 16: 45,411,244 (GRCm39) M934L possibly damaging Het
Spidr T C 16: 15,786,504 (GRCm39) E413G probably benign Het
Taar1 A G 10: 23,797,205 (GRCm39) Y301C probably damaging Het
Tada2b A T 5: 36,633,761 (GRCm39) D197E probably benign Het
Taf1c G T 8: 120,327,224 (GRCm39) Y418* probably null Het
Tanc2 A G 11: 105,805,796 (GRCm39) D394G probably damaging Het
Tnpo3 T C 6: 29,579,688 (GRCm39) D235G probably benign Het
Tns3 G A 11: 8,401,133 (GRCm39) A1055V probably benign Het
Wdfy3 A G 5: 102,009,266 (GRCm39) Y2767H probably damaging Het
Zfhx3 A G 8: 109,519,394 (GRCm39) N172S probably damaging Het
Zfp839 T C 12: 110,821,597 (GRCm39) V137A probably benign Het
Other mutations in Slx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Slx4 APN 16 3,808,752 (GRCm39) missense probably benign 0.17
IGL01767:Slx4 APN 16 3,808,112 (GRCm39) missense probably benign 0.01
IGL02525:Slx4 APN 16 3,798,461 (GRCm39) missense probably damaging 1.00
slim UTSW 16 3,808,774 (GRCm39) nonsense probably null
R0033:Slx4 UTSW 16 3,805,864 (GRCm39) missense probably benign 0.08
R0070:Slx4 UTSW 16 3,805,880 (GRCm39) missense possibly damaging 0.71
R0070:Slx4 UTSW 16 3,805,880 (GRCm39) missense possibly damaging 0.71
R0242:Slx4 UTSW 16 3,804,816 (GRCm39) missense probably damaging 0.99
R0242:Slx4 UTSW 16 3,804,816 (GRCm39) missense probably damaging 0.99
R0363:Slx4 UTSW 16 3,797,953 (GRCm39) missense probably damaging 1.00
R0433:Slx4 UTSW 16 3,803,882 (GRCm39) missense probably benign 0.01
R0993:Slx4 UTSW 16 3,803,689 (GRCm39) missense probably benign 0.00
R1083:Slx4 UTSW 16 3,808,774 (GRCm39) nonsense probably null
R1373:Slx4 UTSW 16 3,803,374 (GRCm39) missense probably benign 0.02
R1710:Slx4 UTSW 16 3,817,022 (GRCm39) missense probably benign 0.15
R1712:Slx4 UTSW 16 3,809,458 (GRCm39) missense probably damaging 0.99
R1874:Slx4 UTSW 16 3,804,712 (GRCm39) missense probably benign 0.25
R1937:Slx4 UTSW 16 3,805,030 (GRCm39) makesense probably null
R2008:Slx4 UTSW 16 3,797,785 (GRCm39) missense probably damaging 1.00
R2156:Slx4 UTSW 16 3,804,223 (GRCm39) missense probably benign 0.00
R2427:Slx4 UTSW 16 3,806,851 (GRCm39) missense probably damaging 0.99
R3890:Slx4 UTSW 16 3,797,773 (GRCm39) missense probably damaging 1.00
R3891:Slx4 UTSW 16 3,797,773 (GRCm39) missense probably damaging 1.00
R4465:Slx4 UTSW 16 3,806,919 (GRCm39) missense possibly damaging 0.82
R4467:Slx4 UTSW 16 3,806,919 (GRCm39) missense possibly damaging 0.82
R4497:Slx4 UTSW 16 3,812,773 (GRCm39) missense probably damaging 1.00
R4882:Slx4 UTSW 16 3,798,860 (GRCm39) critical splice acceptor site probably null
R5119:Slx4 UTSW 16 3,819,063 (GRCm39) missense possibly damaging 0.89
R5384:Slx4 UTSW 16 3,808,669 (GRCm39) missense probably damaging 1.00
R5472:Slx4 UTSW 16 3,809,404 (GRCm39) missense probably benign 0.13
R5578:Slx4 UTSW 16 3,804,726 (GRCm39) missense probably damaging 1.00
R5582:Slx4 UTSW 16 3,803,652 (GRCm39) missense possibly damaging 0.93
R5696:Slx4 UTSW 16 3,797,831 (GRCm39) missense probably damaging 1.00
R5827:Slx4 UTSW 16 3,819,148 (GRCm39) missense possibly damaging 0.94
R5964:Slx4 UTSW 16 3,818,815 (GRCm39) critical splice donor site probably null
R6032:Slx4 UTSW 16 3,798,021 (GRCm39) missense probably damaging 1.00
R6032:Slx4 UTSW 16 3,798,021 (GRCm39) missense probably damaging 1.00
R6039:Slx4 UTSW 16 3,803,911 (GRCm39) missense possibly damaging 0.82
R6039:Slx4 UTSW 16 3,803,911 (GRCm39) missense possibly damaging 0.82
R6345:Slx4 UTSW 16 3,808,714 (GRCm39) missense probably benign 0.06
R6612:Slx4 UTSW 16 3,803,140 (GRCm39) missense probably damaging 0.99
R6979:Slx4 UTSW 16 3,802,879 (GRCm39) missense probably damaging 0.96
R6989:Slx4 UTSW 16 3,813,702 (GRCm39) missense probably damaging 1.00
R7171:Slx4 UTSW 16 3,808,650 (GRCm39) missense probably benign
R7214:Slx4 UTSW 16 3,806,844 (GRCm39) missense probably benign 0.18
R7354:Slx4 UTSW 16 3,804,963 (GRCm39) missense probably benign 0.28
R7490:Slx4 UTSW 16 3,797,995 (GRCm39) missense possibly damaging 0.91
R7545:Slx4 UTSW 16 3,817,164 (GRCm39) missense probably benign 0.11
R7547:Slx4 UTSW 16 3,803,436 (GRCm39) missense probably benign 0.05
R7790:Slx4 UTSW 16 3,804,846 (GRCm39) missense probably benign 0.03
R8119:Slx4 UTSW 16 3,803,136 (GRCm39) nonsense probably null
R8815:Slx4 UTSW 16 3,803,458 (GRCm39) missense probably benign 0.26
R8955:Slx4 UTSW 16 3,808,111 (GRCm39) missense probably benign
R9205:Slx4 UTSW 16 3,805,927 (GRCm39) missense possibly damaging 0.74
R9321:Slx4 UTSW 16 3,804,654 (GRCm39) missense probably benign 0.06
R9364:Slx4 UTSW 16 3,805,820 (GRCm39) missense probably benign 0.00
R9544:Slx4 UTSW 16 3,797,917 (GRCm39) missense probably damaging 0.97
R9554:Slx4 UTSW 16 3,805,820 (GRCm39) missense probably benign 0.00
R9632:Slx4 UTSW 16 3,803,969 (GRCm39) missense probably benign 0.00
R9665:Slx4 UTSW 16 3,806,890 (GRCm39) missense probably benign 0.28
R9718:Slx4 UTSW 16 3,804,328 (GRCm39) missense possibly damaging 0.73
R9772:Slx4 UTSW 16 3,818,849 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ACCTTGAAGGGTTGCAGGTC -3'
(R):5'- TACTCAGTGACATCAGTGCTC -3'

Sequencing Primer
(F):5'- CAGGTCTCAGTGGTAGATGCC -3'
(R):5'- ACACTGTGGGGACATCTCTG -3'
Posted On 2015-04-02