Incidental Mutation 'R3765:Olfr19'
ID274678
Institutional Source Beutler Lab
Gene Symbol Olfr19
Ensembl Gene ENSMUSG00000048101
Gene Nameolfactory receptor 19
SynonymsGA_x54KRFPKG5P-13123979-13123050, M12, MTPCR15, MOR140-1
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R3765 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16672228-16676405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16673315 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 222 (V222A)
Ref Sequence ENSEMBL: ENSMUSP00000145655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057886] [ENSMUST00000206365]
Predicted Effect probably benign
Transcript: ENSMUST00000057886
AA Change: V222A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053393
Gene: ENSMUSG00000048101
AA Change: V222A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 190 9.6e-8 PFAM
Pfam:7tm_1 41 290 2.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206365
AA Change: V222A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206799
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Polr1c C T 17: 46,247,924 V14M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Olfr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr19 APN 16 16673265 missense probably damaging 1.00
IGL01790:Olfr19 APN 16 16673103 missense probably damaging 1.00
IGL03105:Olfr19 APN 16 16673526 missense probably benign 0.00
PIT4418001:Olfr19 UTSW 16 16673855 missense probably damaging 1.00
R1891:Olfr19 UTSW 16 16673577 missense probably damaging 0.99
R1969:Olfr19 UTSW 16 16673583 missense probably benign 0.00
R2138:Olfr19 UTSW 16 16673205 missense probably damaging 1.00
R4193:Olfr19 UTSW 16 16673647 missense possibly damaging 0.76
R4565:Olfr19 UTSW 16 16673693 missense probably damaging 0.99
R4897:Olfr19 UTSW 16 16673618 missense probably damaging 1.00
R5753:Olfr19 UTSW 16 16673620 nonsense probably null
R6505:Olfr19 UTSW 16 16673920 missense probably benign 0.01
R7460:Olfr19 UTSW 16 16673166 missense possibly damaging 0.77
R7562:Olfr19 UTSW 16 16673715 missense probably benign 0.00
R7818:Olfr19 UTSW 16 16673573 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAATGGGTTCAACATGGGG -3'
(R):5'- CATTGAATTCCTTGCTGCAGAG -3'

Sequencing Primer
(F):5'- GGTTCAACATGGGGGTGAC -3'
(R):5'- CTTGCTGCAGAGTTCAATGGCAC -3'
Posted On2015-04-02