Incidental Mutation 'R3765:Polr1c'
ID 274682
Institutional Source Beutler Lab
Gene Symbol Polr1c
Ensembl Gene ENSMUSG00000067148
Gene Name polymerase (RNA) I polypeptide C
Synonyms RPA40, Rpo1-1, 40kDa
MMRRC Submission 040742-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3765 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 46243920-46248054 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46247924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 14 (V14M)
Ref Sequence ENSEMBL: ENSMUSP00000133861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000095263] [ENSMUST00000123311] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
AlphaFold P52432
Predicted Effect probably benign
Transcript: ENSMUST00000087026
AA Change: V14M

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148
AA Change: V14M

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095263
SMART Domains Protein: ENSMUSP00000092897
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123311
SMART Domains Protein: ENSMUSP00000115951
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124126
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127378
SMART Domains Protein: ENSMUSP00000114937
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
Pfam:Yip1 30 178 4.6e-13 PFAM
low complexity region 189 201 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142706
AA Change: V14M

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148
AA Change: V14M

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152583
Predicted Effect possibly damaging
Transcript: ENSMUST00000173232
AA Change: V14M

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148
AA Change: V14M

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174392
Predicted Effect probably damaging
Transcript: ENSMUST00000173349
AA Change: V14M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148
AA Change: V14M

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of both RNA polymerase I and RNA polymerase III complexes. The encoded protein is part of the Pol core element. Mutations in this gene have been associated with Treacher Collins syndrome (TCS) and hypomyelinating leukodystrophy 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,608,837 V403A probably benign Het
Arid2 T C 15: 96,370,714 S903P probably benign Het
Arl6ip6 T A 2: 53,192,231 W37R probably damaging Het
Bag3 C T 7: 128,540,271 T162I probably benign Het
C4b G A 17: 34,729,840 P1545S probably damaging Het
Ccdc185 T A 1: 182,747,552 H524L possibly damaging Het
Cfap43 T C 19: 47,835,575 N119S probably benign Het
Churc1 C A 12: 76,773,283 S22* probably null Het
Crbn T C 6: 106,795,026 K106E possibly damaging Het
Dag1 C T 9: 108,208,199 G581E probably damaging Het
Dpp4 T A 2: 62,386,436 T92S probably benign Het
Fam135a T C 1: 24,055,877 T137A possibly damaging Het
Fermt1 T C 2: 132,906,702 D667G possibly damaging Het
Foxl2 T A 9: 98,955,986 I109N probably damaging Het
Frk A G 10: 34,484,005 M1V probably null Het
Fuk A G 8: 110,887,104 I775T probably benign Het
Gstm2 A G 3: 107,984,030 F124S probably damaging Het
Hmcn1 T C 1: 150,745,025 S1145G possibly damaging Het
Ints10 A G 8: 68,825,119 T682A possibly damaging Het
Jmy T C 13: 93,464,711 M396V possibly damaging Het
Ldb3 A T 14: 34,578,682 probably null Het
Mre11a A G 9: 14,809,847 N354S probably benign Het
Nbea A G 3: 56,005,549 V939A probably damaging Het
Nphs1 T C 7: 30,471,210 S928P probably damaging Het
Olfr1463 G A 19: 13,234,431 M60I probably damaging Het
Olfr19 A G 16: 16,673,315 V222A probably benign Het
Olfr311 T C 11: 58,841,294 F60S probably damaging Het
Olfr954 T A 9: 39,461,624 Y61* probably null Het
Pla2g12b G A 10: 59,421,501 V169M probably damaging Het
Prg4 G A 1: 150,451,371 S898L probably damaging Het
Prmt6 C A 3: 110,250,194 E260* probably null Het
Ptx4 A G 17: 25,122,868 T106A probably benign Het
Rab3il1 A G 19: 10,028,309 T87A probably damaging Het
Sbf2 A G 7: 110,375,581 V783A probably damaging Het
Scn2a A C 2: 65,682,710 D209A possibly damaging Het
Setd2 T C 9: 110,594,246 L345P probably damaging Het
Slc18b1 A G 10: 23,798,749 D34G probably damaging Het
Slc9c1 A T 16: 45,590,881 M934L possibly damaging Het
Slx4 A G 16: 3,980,986 V1357A probably damaging Het
Spidr T C 16: 15,968,640 E413G probably benign Het
Taar1 A G 10: 23,921,307 Y301C probably damaging Het
Tada2b A T 5: 36,476,417 D197E probably benign Het
Taf1c G T 8: 119,600,485 Y418* probably null Het
Tanc2 A G 11: 105,914,970 D394G probably damaging Het
Tnpo3 T C 6: 29,579,689 D235G probably benign Het
Tns3 G A 11: 8,451,133 A1055V probably benign Het
Wdfy3 A G 5: 101,861,400 Y2767H probably damaging Het
Zfhx3 A G 8: 108,792,762 N172S probably damaging Het
Zfp839 T C 12: 110,855,163 V137A probably benign Het
Other mutations in Polr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Polr1c APN 17 46244209 missense probably damaging 1.00
IGL02035:Polr1c APN 17 46246159 missense possibly damaging 0.72
R0068:Polr1c UTSW 17 46244903 missense probably benign 0.00
R0457:Polr1c UTSW 17 46247763 missense probably benign 0.00
R0828:Polr1c UTSW 17 46245064 missense probably damaging 0.96
R0881:Polr1c UTSW 17 46244613 missense possibly damaging 0.69
R1322:Polr1c UTSW 17 46244163 missense possibly damaging 0.74
R1518:Polr1c UTSW 17 46247895 missense possibly damaging 0.89
R4212:Polr1c UTSW 17 46246120 missense probably damaging 0.97
R4548:Polr1c UTSW 17 46247809 splice site probably null
R5017:Polr1c UTSW 17 46247709 intron probably benign
R5018:Polr1c UTSW 17 46247709 intron probably benign
R5039:Polr1c UTSW 17 46247709 intron probably benign
R5167:Polr1c UTSW 17 46247709 intron probably benign
R5168:Polr1c UTSW 17 46247709 intron probably benign
R5971:Polr1c UTSW 17 46247709 intron probably benign
R6979:Polr1c UTSW 17 46246169 missense probably damaging 1.00
R7812:Polr1c UTSW 17 46246127 missense probably damaging 1.00
R7869:Polr1c UTSW 17 46244891 missense probably benign 0.00
R8025:Polr1c UTSW 17 46245048 missense probably damaging 1.00
R9186:Polr1c UTSW 17 46245707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAAGCGTGTTGTATGGAAAC -3'
(R):5'- CTTGACGTCCGGAAGTGAAG -3'

Sequencing Primer
(F):5'- ACCTTCTCGAAGCGGTTCTGG -3'
(R):5'- TCCGGAAGTGAAGGACGTG -3'
Posted On 2015-04-02